Astragalus membranaceus is a perennial herb belonging to the Fabaceae family that is primarily distributed across northern Asia (Tan et al., 2019; D’Avino et al., 2023). A. membranaceus roots have long been used as a key pharmaceutical component in traditional Chinese medicine. Their pharmacological effects, which are mainly attributed to astragalosides, have been studied to determine their potential to modulate immune function and antioxidant properties (Adesso et al., 2018; Chen et al., 2021). By contrast, the physiological activities of the aerial parts of A. membranaceus, which are only consumed as tea in China, remain unknown.

Recently, the prevalence of allergic diseases, particularly type I allergies (e.g., pollen hypersensitivity), has increased (Song et al., 2015; Almatroudi et al., 2021; Yagi et al., 2024). Allergies are adverse immune responses to harmless substances, including pollen. During allergic response, basophils and mast cells play pivotal roles. These cells are activated when immunoglobulin (Ig) E conjugated to Fce receptor I on the cellular membrane is cross-linked with a specific allergen, which triggers downstream intracellular signal transduction (Kawasaki et al., 1994; Siraganian, 2003). This stimulation induces the influx of intracellular calcium ions (Ca²⁺), leading to the release of histamine by degranulation and causing allergic symptoms such as a runny nose. During signal transduction, 5-lipoxygenase (LOX) oxidizes arachidonate released from the cellular membrane to produce leukotrienes (LTs). LTB₄ induces the migration of immune cells, including macrophages (Wang et al., 2021), to the site of an allergic reaction (Oh et al., 2010) and causes chronic allergic symptoms (Lotfi et al., 2020). The chemical mediators that enhance vascular permeability during allergic responses promote inflammation, wherein macrophages play a central role (Björk et al., 1982; Nicoletti et al., 2012; Ashina et al., 2015). Macrophages are activated when external substances, including lipopolysaccharides (LPS), from bacteria interact with toll-like receptors (TLRs) on cellular membranes. This stimulation initiates intracellular signaling pathways, which produce proinflammatory cytokines, including interleukin (IL)-1β and IL-6 (Lee et al., 2016; Li et al., 2023a). The pathway of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) is essential in this process as its activation regulates the transcription of inflammation-related genes (Liu et al., 2017; Verghese et al., 2018). Moreover, macrophages produce nitric oxide (NO) and prostaglandin (PG) E₂, which amplify the inflammatory response (Lee et al., 2018).

Recently, natural compounds from plants, including polyphenols, have attracted attention as they exhibit physiological activities that alleviate various diseases (Kumar and Pandey, 2013; Castell et al., 2014; Ko et al., 2018). Many natural bioactive compounds are used clinically and have the potential to replace conventional Western medicines (Chin et al., 2006; Zhang et al., 2013). Previous studies have demonstrated the potential of functional foods to mitigate allergic symptoms and inflammation with minimal side effects (Kawai et al., 2007). In the present study, the antiallergic and anti-inflammatory activities of the A. membranaceus leaf extract (AMLE) were investigated using immune cell lines. Furthermore, the mechanisms underlying the inhibitory effects of AMLE on allergic and inflammatory reactions were evaluated, and the causative agents were identified.

Chemicals

Astragaloside IV and calycosin were purchased from Chemscene and Cayman Chemical Co., respectively. Kaempferol and quercetin were obtained from Tokyo Chemical Industry, and 2,2-diphenyl-1-picrylhydrazyl (DPPH) was purchased from FUJIFILM Wako Pure Chemicals. All reagents used in this study were of analytical grade.

Preparation of the A. membranaceus extract

A. membranaceus was cultivated in Rikubetsu, Hokkaido, Japan. The leaves and roots of A. membranaceus plants were air-dried and finely chopped. A portion of the sample (18 g) was stirred in 1 L of water at 80°C for 20 min. Subsequently, the extract was filtered. To maximize the yield, the extraction process was repeated using the remaining residue. The extract solution was lyophilized to obtain AMLE and A. membranaceus root extract (AMRE) powders. The AMLE and AMRE yields were 39.1% and 13.9%, respectively.

Determination of total polyphenols

The Folin-Ciocalteu method was used to quantify the total polyphenols in AMLE and AMRE (Chapin, 1921). Briefly, a 200-µL aliquot of each sample dissolved in water was mixed with 200 µL of 1 N Folin-Ciocalteu reagent (Nacalai Tesque) and incubated at 25°C for 3 min. Subsequently, the mixture was added with 200 µL of 10% sodium carbonate. Then, it was allowed to react in the dark at 30°C for 30 min. The absorbance of the resulting solution was measured at 760 nm. Moreover, the total polyphenol content was calculated using a gallic acid calibration curve prepared under the same experimental conditions and expressed as gallic acid equivalents (mg GAE).

Antioxidant activity assay

DPPH assay was used to evaluate the antioxidant activities of AMLE and AMRE based on their radical scavenging abilities (Zorig et al., 2021). An appropriate amount of the sample was mixed with 100 µM DPPH in 75% ethanol and then reacted in the dark at 30°C for 30 min. The reaction mixture was centrifuged at 20,000 g for 5 min, and the absorbance of the resulting supernatant was measured at 517 nm.

Flavonol aglycone analysis

Reversed-phase high-performance liquid chromatography (RP-HPLC) was used to analyze the flavonol aglycones in AMLE in accordance with the method of a previous study (Qiu et al., 2023). The sample was hydrolyzed with 0.65 M HCl at 90°C for 1 h. The flavonol aglycones in the hydrolysate were injected into an InertSustain C18 column (5 µm, 4.6×250 mm, GL Science) maintained at 40°C. Separation was achieved using a mobile phase of 0.5% H₃PO₄ (A) and methanol (B) at a flow rate of 0.7 mL/min. The gradient elution program was as follows: 40%－60% B from 0 min to 10 min, isocratic at 60% B from 10 min to 21 min, 60%－40% B from 21 min to 23 min, and isocratic at 40% B from 23 min to 38 min. The absorbance of the eluent was measured at 370 nm.

Cell culture

The rat basophilic leukemia cell line (RBL-2H3) and mouse mast cell line (PB-3c) were supplied by the JCRB Cell Bank. The mouse macrophage cell line (RAW 264) was provided by the RIKEN BioResource Research Center. RBL-2H3 cells were cultured in Eagle’s Minimal Essential Medium (MEM; FUJIFILM) supplemented with 10% fetal bovine serum (FBS; HyClone Laboratories), 100 units/mL of penicillin, and 100 µg/mL of streptomycin (FUJIFILM). PB-3c cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (FUJIFILM) containing 1 mM sodium pyruvate, 2 mM L-glutamine, and 25 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid supplemented with 10% FBS, 1% non-essential amino acids (Gibco), 4 µL/L of 2-mercaptoethanol, 2 µg/L of IL-3 (FUJIFILM), 100 units/mL of penicillin, and 100 µg/mL of streptomycin. RAW 264 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; FUJIFILM) supplemented with 10% FBS, 100 units/mL of penicillin, and 100 µg/mL of streptomycin. All cell cultures were maintained under standard conditions at 37°C in a humidified atmosphere containing 5% CO₂.

The trypan blue dye exclusion method, a widely accepted technique for determining cell viability, was used to assess the sample cytotoxicity to RBL-2H3 and PB-3c cells. Meanwhile, the Cell Counting Kit-8 (Dojindo) was used to evaluate the sample cytotoxicity to RAW 264 cells (Zhao et al., 2017).

Histamine release assay

The inhibitory effects of AMLE and AMRE on histamine release from RBL-2H3 cells were evaluated in accordance with previously reported methods (Matsuo et al., 1997; Qiu et al., 2023). RBL-2H3 cells were sensitized with mouse anti-2,4-dinitrophenyl (DNP) IgE monoclonal antibody (Yamasa) in the medium at a density of 4×10⁵ cells/well in 24-well microplates for 20 h. Then, the cells were rinsed twice with phosphate-buffered saline (PBS) (pH 7.4) and incubated with various concentrations of samples in 450 µL of Tyrode buffer (pH 7.2) comprising 137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl₂, 1 mM MgCl₂, 12 mM NaHCO₃, 0.4 mM NaH₂PO₄, and 5.6 mM glucose supplemented with 0.05% bovine serum albumin (BSA) (Sigma-Aldrich) at 37°C for 10 min. To induce cell stimulation, 50 µL of 2 µg/mL DNP-BSA (Millipore) was added in Tyrode buffer at 37°C for 20 min. To determine the total histamine content in cytoplasmic granules and baseline histamine release without stimulation, 50 µL of 5% Triton X-100 and Tyrode buffer without DNP-BSA were added, respectively. A 100-µL aliquot of the culture supernatant was mixed with 50 µL of 200 mM N-acetyl-L-cysteine and 50 µL of 8 µM 1-methylhistamine as an internal standard. The histamine concentration in the mixtures was analyzed by RP-HPLC using a Shodex ODP-50-4E column (5 µm, 4.6×250 mm; Showa Denko) maintained at 50°C (von Vietinghoff et al., 2006). The analytes were isocratically eluted with a methanol/water mixture (35:65, v/v) containing 30 mM Na₂B₄O₇ and 0.2 mM o-phthalaldehyde at a flow rate of 0.7 mL/min. The fluorescence of the derivatives in the eluate was detected using an excitation and emission wavelength of 340 and 450 nm, respectively.

Leukotriene B₄ production assay

The inhibitory effects of AMLE and AMRE on LTB₄ production in PB-3c cells were evaluated in accordance with a previously reported method (Takasugi et al., 2018). The PB-3c cells were cultured with 50 µM of arachidonate in the medium for 48 h. After the cells were rinsed twice with PBS, 4×10⁶ cells were incubated with various concentrations of samples in 180 µL of Tyrode buffer at 37°C for 10 min. To induce cell stimulation, 20 µL of 10 µM calcium ionophore (A23187, Merck) was added at 37°C for 20 min. To terminate the stimulation, 200 µL of an acetonitrile/methanol mixture (30:25, v/v) containing 1 mM ascorbic acid, 2 mM ethylenediaminetetraacetic acid (EDTA), and 1 µM PGB₂ (Cayman Chemical) as an internal standard was added. The reaction mixture was centrifuged at 20,000 g at 4°C for 15 min, and the LTB₄ concentration in the supernatant was determined by RP-HPLC using an octadecylsilane column (5 µm, 6.0×150 mm; YMC-Pack ODS-A, YMC) maintained at 40°C. The analytes were isocratically eluted with an acetonitrile/methanol/water mixture (25:45:30, v/v/v) containing 5 mM CH₃COONH₄ at a flow rate of 1.0 mL/min. The absorbance of the eluate was measured at 280 nm.

Measurement of cytoplasmic calcium ions

The intracellular Ca²⁺ concentration in RBL-2H3 cells during stimulation was measured using the Calcium Kit II-Fluo 4 (Dojindo Laboratories) (Zorig et al., 2021). RBL-2H3 cells were sensitized with anti-DNP IgE at a density of 3×10⁴ cells/well in 96-well microplates at 37°C for 20 h. Various concentrations of samples and 5 µg/mL of Fluo 4-AM (a Ca²⁺-sensitive fluorescent dye) were added to the cells and incubated at 37°C for 1 h. Cell stimulation was induced by DNP-BSA, and the fluorescence intensity (excitation wavelength, 485 nm; emission wavelength, 520 nm) was continuously monitored at 37°C using a fluorescence microplate reader (Wallac 1420 ARVO MX/Light, PerkinElmer).

Nitric oxide and prostaglandin E₂ release assay

RAW 264 cells were seeded into 24-well microplates at a density of 4×10⁵ cells/well and allowed to adhere for 2 h. The cells were incubated with various concentrations of samples in 495 µL of phenol red-free medium at 37°C for 30 min. Cell stimulation was induced by adding 5 µL of 100 µg/mL LPS (Sigma-Aldrich), and the cells were maintained at 37°C. The NO in the culture supernatant was measured after 24 h using the NO₂/NO₃ Assay Kit-FX with 2,3-diaminonaphthalene (Dojindo Laboratories). After 6 h, the PGE₂ in the culture supernatant was determined using an enzyme-linked immunosorbent assay (ELISA) kit with a monoclonal antibody (Cayman Chemicals).

Measurement of inflammatory cytokines

LPS was used to induce the stimulation of RAW 264 cells, as described previously. The IL-1β concentration in the culture supernatant was determined using an ELISA kit (R&D Systems) after 24 h of stimulation. Meanwhile, the IL-6 concentration in the culture supernatant was determined using an ELISA kit (Mabtech) after 6 h of stimulation.

Analysis of mRNA

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using the SYBR Green Fast Advanced Cells-to-Ct Kit (Thermo Fisher Scientific) to measure the expression levels of 5-LOX, mRNA in RBL-2H3 cells, as well as inducible nitric oxide synthase (iNOS) mRNA, and microsomal prostaglandin E synthase-1 (mPGES-1) mRNA in RAW 264 cells. The stimulated cells were lysed in the presence of DNase I, and complementary DNA was synthesized via reverse transcription in accordance with the manufacturer’s instructions. RT-qPCR was performed using the LightCycler 96 System (Roche) with SYBR Green as the detection dye. The thermal cycling conditions comprised an initial enzyme activation step at 95°C for 10 min, followed by 45 amplification cycles comprising denaturation at 95°C for 3 s and annealing/extension at 60°C for 30 s. After the reaction, melting curve analysis was performed to ensure amplification specificity and the presence of a single product. The Primer-BLAST online tool was used to design the primer sequences used for RT-qPCR (Table 1). The relative gene expression levels were calculated using the 2^−ΔΔCt method with normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control gene.

Table 1 . Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Gene	Sequence (5’-3’)
5-LOX	Forward	CCCCACGGGGACTACATAGA
	Reverse	TCGGGCCAATTTTGCACATC
iNOS	Forward	CGGCAAACATGACTTCAGGC
	Reverse	GCACATCAAAGCGGCCATAG
mPGES-1	Forward	GCCAACGACATGGAGACAATC
	Reverse	ATGTATCCAGGCGATCAGAGG
GAPDH	Forward	TGTGTCCGTCGTGGATCTGA
	Reverse	TTGCTGTTGAAGTCGCAGGAG

5-LOX, 5-lipoxygenase; iNOS, inducible nitric oxide synthase; mPGES-1, microsomal prostaglandin E synthase-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase..

Analysis of proteins

The protein expression levels of iNOS and mPGES-1 in RAW 264 cells were assessed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis in accordance with previous studies (Laemmli, 1970; Zorig et al., 2021). The stimulated cells in a 24-well microplate were rinsed twice with cold tris-buffered saline (TBS) (pH 7.4) containing 1 mM EDTA and lysed using radioimmunoprecipitation assay lysis buffer (ATTO Corporation) supplemented with 1% protease inhibitor. Then, the lysates were incubated on ice for 15 min, collected with a cell scraper, and centrifuged at 20,000 g at 4°C for 20 min. The resulting supernatant was mixed with Laemmli Sample Buffer (Bio-Rad Laboratories) and heated at 95°C for 5 min. The proteins were separated using SDS-PAGE with Any kD TGX gels (Bio-Rad) and transferred onto polyvinylidene difluoride membranes. The membranes were blocked using Intercept Blocking Buffer (LI-COR) for 1 h, rinsed with TBS containing 0.05% Tween-20, and shaken for 2 h with the primary antibodies. The antibodies used targeted iNOS (rabbit polyclonal, GeneTex), mPGES-1 (mouse polyclonal, Abcam), or β-actin (mouse monoclonal, clone 8H10D10; Cell Signaling Technology), each prepared in Can Get Signal Immunoreaction Enhancer Solution (TOYOBO). After incubation with the primary antibodies, the membranes were rinsed with 0.05% Tween-TBS and shaken for 1 h with the secondary polyclonal antibodies conjugated with IRDye 680RD or 800CW (LI-COR) specific to mouse or rabbit IgG. The immunoreactive proteins were detected by near-infrared fluorescence at 680 and 800 nm using the Odyssey CLx Imaging System (LI-COR).

Analysis of NF-κB translocation

Nuclear fractions were extracted from stimulated RAW 264 cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions. As described previously, the isolated nuclear proteins were analyzed by SDS-PAGE and Western blot with a primary polyclonal rabbit antibody specific for NF-κB p65 (Thermo Fisher Scientific).

Statistical analysis

All experiments were repeated multiple times to ensure reproducibility in order to confirm the reliability of the results. All experimental data (n=3) were expressed as the mean±standard deviation. The Tukey-Kramer multiple comparison test or Student’s t-test was used to perform group comparisons using the Mac Statistical Analysis software (version 3.0, Esumi). Statistical significance was considered at P<0.05.

Polyphenol content and radical scavenging ability

AMLE had a significantly higher polyphenol content (51.5 mg GAE/g dry weight) than AMRE (5.8 mg GAE/g dry weight) (Fig. 1A). Moreover, AMLE had a stronger DPPH radical scavenging ability [50% inhibitory concentration (IC₅₀)=0.16 mg/mL] than AMRE (IC₅₀=5.34 mg/mL) (Fig. 1B).

Figure 1. Polyphenol contents and radical scavenging abilities of Astragalus membranaceus leaf extract (AMLE) and A. membranaceus root extract (AMRE). (A) Polyphenol content. The results are expressed as milligram gallic acid equivalents (GAE). (B) Radical scavenging ability. AMLE (●) and AMRE (▲). Values are presented as the mean±SD (n=3). Different letters (a, b) indicate a significant difference (P<0.05) between groups.

Release of chemical mediators in allergic cell response

The effects of AMLE and AMRE on the release of chemical mediators during allergic response are shown in Fig. 2. AMLE significantly suppressed the release of histamine from stimulated RBL-2H3 cells at 1.0 mg/mL (Fig. 2A), whereas AMRE tended to suppress the release of histamine. AMLE and AMRE significantly suppressed the production of LTB₄ in stimulated PB-3c cells at 1.0 mg/mL (Fig. 2B), with the former showing a markedly stronger inhibitory activity than the latter. AMLE inhibited the release of histamine at 0.5, 1.0, and 2.0 mg/mL in a concentration-dependent manner (Fig. 2C). In addition, AMLE inhibited the production of LTB₄ at 0.2, 0.5, and 1.0 mg/mL in a concentration-dependent manner (Fig. 2D). The results of the trypan blue dye exclusion assay confirmed that neither AMLE nor AMRE was toxic to RBL-2H3 and PB-3c cells up to 2.0 and 1.0 mg/mL, respectively (Supplementary Fig. 1).

Figure 2. Effects of Astragalus membranaceus leaf extract (AMLE) and A. membranaceus root extract (AMRE) on the release of chemical mediators in the allergic cell response. (A) Release of histamine from stimulated RBL-2H3 cells. (B) Leukotriene (LT) B₄ production by stimulated PB-3c cells. (C) Dose-dependent inhibitory effects of AMLE on the release of histamine. (D) Dose-dependent inhibitory effects of AMLE on the production of LTB₄. Values are presented as the mean±SD (n=3). Different letters (a-d) indicate significant differences (P<0.05) between groups. RBL-2H3, rat basophilic leukemia cell line; PB-3c, mouse mast cell line.

Intracellular Ca²⁺ influx and 5-lipoxygenase expression in allergic response

The effects of AMLE on the changes in cytoplasmic Ca²⁺ concentration in the stimulated RBL-2H3 cells are shown in Fig. 3A. In the control group, the relative fluorescence intensity increased progressively after the stimulation (indicated by the arrow), whereas no significant changes were observed without stimulation. However, this stimulation-induced increase was suppressed with AMLE treatment at concentrations of 0.5 and 1.0 mg/mL in a concentration-dependent manner. The effects of AMLE on 5-LOX mRNA expression in stimulated RBL-2H3 cells are shown in Fig. 3B. Antigen stimulation increased 5-LOX mRNA levels; however, this expression was significantly inhibited by AMLE treatment (1.0 mg/mL).

Figure 3. Effects of Astragalus membranaceus leaf extract (AMLE) on intracellular calcium ion influx and 5-lipoxygenase (5-LOX) expression in allergic response. (A) Time course analysis of cytoplasmic calcium ion concentrations in RBL-2H3 cells. Unstimulated (○), control (●), 0.5 mg/mL of AMLE (▲), and 2.0 mg/mL of AMLE (■). (B) 5-LOX mRNA expression in RBL-2H3 cells. The values were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase. Values are presented as the mean±SD (n=3). Different letters (a-c) indicate significant differences (P<0.05) between groups. RBL-2H3, rat basophilic leukemia cell line.

Release of chemical mediators in inflammatory cell response

The effects of the A. membranaceus extracts on NO and PGE₂ release during inflammatory response are shown in Fig. 4A and 4B, respectively. AMLE significantly suppressed the release of NO and PGE₂ from stimulated RAW 264 cells at 0.2, 0.5, and 1.0 mg/mL in a concentration-dependent manner, whereas AMRE exhibited no effects at 1.0 mg/mL. The results of cell viability assay confirmed that AMLE and AMRE were not toxic to RAW 264 cells up to 1.0 mg/mL for 24 h (Supplementary Fig. 1).

Figure 4. Effects of Astragalus membranaceus leaf extract (AMLE) and A. membranaceus root extract (AMRE) on the release of chemical mediator in inflammatory cell response. (A) Nitric oxide (NO) release from RAW 264 cells. (B) Prostaglandin E₂ (PGE₂) from RAW 264 cells. Values are presented as the mean±SD (n=3). Different letters (a-e) indicate significant differences (P<0.05) between groups. RAW 264, mouse macrophage cell line.

Expression levels of chemical mediator synthesis enzymes in inflammatory cell response

The effects of AMLE on the mRNA expression levels of chemical mediator synthesis enzymes in LPS-stimulated RAW 264 cells are shown in Fig. 5. AMLE significantly inhibited the expression of iNOS (Fig. 5A) and mPGES-1 (Fig. 5B) at 1.0 mg/mL. The effects of AMLE on the protein expression levels of chemical mediator synthesis enzymes in LPS-stimulated RAW 264 cells are shown in Fig. 6. The results of Western blot analysis showed that AMLE (1.0 mg/mL) reduced the intensity of the iNOS band, corresponding to a molecular weight of 131 kDa (Fig. 6A, lane 2), compared with the control (lane 1). Based on triplicate experiments, the relative band intensities of iNOS normalized to β-actin at 42 kDa as a loading control for the total protein are shown in Fig. 6B. AMLE significantly inhibited iNOS protein expression. Similarly, AMLE treatment decreased the mPGES-1 band detected at 17 kDa (Fig. 6C) and significantly inhibited mPGES-1 protein expression (Fig. 6D).

Figure 5. Effects of Astragalus membranaceus leaf extract (AMLE) on the mRNA expression of chemical mediator synthesis enzymes in inflammatory response. (A) Inducible nitric oxide synthase (iNOS) in RAW 264 cells. (B) Microsomal prostaglandin E synthase-1 (mPGES-1) in RAW 264 cells. The values were normalized to glyceraldehyde-3-phosphate dehydrogenase. Values are presented as the mean±SD (n=3). Different letters (a-c) indicate significant differences (P<0.05) between groups. RAW 264, mouse macrophage cell line; LPS, lipopolysaccharides.

Figure 6. Effects of Astragalus membranaceus leaf extract (AMLE) on the protein expression of chemical mediator synthesis enzymes in inflammatory response. (A, C) Inducible nitric oxide synthase (iNOS) (131 kDa) and microsomal prostaglandin E synthase-1 (mPGES-1) (17 kDa) in stimulated RAW 264 cells. Lane 1, control (stimulated); Lane 2, AMLE (1.0 mg/mL). The experiments were performed in triplicate, and a representative result is presented. (B, D) Relative band densities of iNOS and mPGES-1 normalized to β-actin (42 kDa). Values are presented as the mean±SD (n=3). Different letters (a, b) indicate a significant difference (P<0.05) between groups. RAW 264, mouse macrophage cell line; LPS, lipopolysaccharides.

Release of cytokines and nuclear translocation of NF-κB in inflammatory cell response

The effects of AMLE on the release of the inflammatory cytokines IL-1β and IL-6 from LPS-stimulated RAW 264 cells are shown in Fig. 7A and 7B, respectively. AMLE treatment at 0.5 and 1.0 mg/mL significantly inhibited the LPS-induced expression of IL-1β and IL-6 in RAW 264 cells in a concentration-dependent manner. The effects of AMLE on the nuclear translocation of NF-κB in LPS-stimulated RAW 264 cells are shown in Fig. 7C. AMLE treatment at 1.0 mg/mL significantly inhibited NF-κB nuclear translocation.

Figure 7. Effects of Astragalus membranaceus leaf extract (AMLE) on cytokine release and nuclear translocation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in inflammatory response. (A, B) Interleukin (IL)-1β and IL-6 release from stimulated RAW 264 cells. (C) Relative NF-κB levels in the nuclear fraction of stimulated RAW 264 cells. Values are presented as the mean±SD (n=3). Different letters (a-d) indicate significant differences (P<0.05) between groups. RAW 264, mouse macrophage cell line; LPS, lipopolysaccharides.

Effects of major A. membranaceus leaf compounds on the release of chemical mediators in allergic and inflammatory cell responses

The effects of major A. membranaceus leaf compounds (e.g., astragaloside IV, calycosin, kaempferol, and quercetin) on the release of histamine, LTB₄, NO, and PGE₂ from the stimulated immune cell lines are shown in Fig. 8A－8D, respectively. Astragaloside IV exhibited no inhibitory effects on the release of any chemical mediators at 40 µM. Kaempferol and quercetin significantly suppressed the release of histamine from stimulated RBL-2H3 cells at 40 µM, with the latter showing a stronger effect than the former. Calycosin had no inhibitory effects on the release of histamine at 40 µM. Kaempferol and quercetin suppressed the production of LTB₄ in stimulated PB-3c cells at 40 µM, with the latter showing a more potent inhibition than the former. Moreover, kaempferol and quercetin significantly inhibited NO release from stimulated RAW 264 cells at 30 µM, with no considerable difference between their activities. Calycosin did not inhibit NO release at 40 µM. Calycosin, kaempferol, and quercetin significantly suppressed PGE₂ release from stimulated RAW 264 cells at 5 µM. Among them, kaempferol exhibited the strongest inhibitory effect, surpassing those of calycosin and quercetin. Meanwhile, calycosin and quercetin showed similar activities. The results of cell viability assay confirmed that astragaloside IV and calycosin were not cytotoxic to RBL-2H3, PB-3c, and RAW 264 cells at concentrations up to 40 µM (Supplementary Fig. 2). Similarly, kaempferol and quercetin were nontoxic to RBL-2H3 and PB-3c cells at concentrations up to 40 µM and to RAW 264 cells at concentrations up to 30 µM (Supplementary Fig. 2). In AMLE, kaempferol (32.8±0.1 µmol/g dry weight) and quercetin (28.6±0.7 µmol/g dry weight) were the primary flavonol aglycones.

Figure 8. Effects of major Astragalus membranaceus leaf compounds on the release of chemical mediators in allergic and inflammatory cell responses. (A) Release of histamine from stimulated RBL-2H3 cells. (B) Production of leukotrienes (LT) B₄ by stimulated PB-3c cells. (C) Nitric oxide (NO) release from stimulated RAW 264 cells. (D) Prostaglandin (PG) E₂ release from stimulated RAW 264 cells. Values are presented as the mean±SD (n=3). Different letters (a-d) indicate significant differences (P<0.05) between groups. RBL-2H3, rat basophilic leukemia cell line; PB-3c, mouse mast cell line; RAW 264, mouse macrophage cell line; LPS, lipopolysaccharides.

Natural plant-derived compounds, including polyphenols, are considered as promising alternatives to conventional Western medicine for mitigating the symptoms of allergic inflammation (Bellik et al., 2012). Using these compounds is expected to offer safe and effective treatment while minimizing the side effects that are commonly associated with conventional medicine. A. membranaceus roots have been used as a component of traditional Chinese herbal medicine. They contain astragaloside IV, a type of saponin with anticancer and neuroprotective effects (Liang et al., 2023). Conversely, owing to their general health benefits, A. membranaceus leaves have primarily been consumed as herbal teas and have not been explored as pharmaceutical agents. Furthermore, the specific bioactivities of A. membranaceus leaves remain unclear. The present study aimed to evaluate the inhibitory effects of AMLE on allergic and inflammatory responses in cell line models and to identify the bioactive compounds responsible for these effects.

Yamada et al. (1999) proposed that the antioxidant properties of phenolic compounds could be involved in suppressing the production of LTB₄ by mast cells. In addition, epigallocatechin gallate, a polyphenol predominantly found in green tea, exhibits potent antioxidant and antiallergic activities (Yamada and Tachibana, 2000). We previously demonstrated that food extracts containing polyphenols possess strong antiallergic and anti-inflammatory activities (Zorig et al., 2021; Qiu et al., 2023; Ochir et al., 2024). These findings suggest that polyphenols with antioxidant properties may exert antiallergic and anti-inflammatory effects. To confirm this, we determined the polyphenol contents of AMLE and AMRE and evaluated their radical scavenging abilities as measures of antioxidant activity. As shown in Fig. 1, AMLE contained a considerably higher amount of polyphenols (A) and exhibited a much stronger radical scavenging ability compared with AMRE (B). These findings indicate that the abundant polyphenols in AMLE contribute to its potent antioxidant activity.

Inhibiting the release of chemical mediators from basophils and mast cells is a critical mechanism for suppressing type I allergic responses (Duangmee et al., 2022). Many studies have evaluated the antiallergic activity of natural components by measuring the β-hexosaminidase activity in culture supernatants, which reflects the degranulation of basophilic leukocytes upon antigen stimulation. In the present study, the antiallergic effects of AMLE were assessed by directly measuring the release of histamine, a key chemical mediator responsible for allergic symptoms, from RBL-2H3 cells stimulated by antigen-IgE reactions (Matsuo et al., 1997; von Vietinghoff et al., 2006; Zorig et al., 2021). As shown in Fig. 2A and 2C, AMLE significantly inhibited the release of histamine from stimulated RBL-2H3 cells in a concentration-dependent manner, with AMLE tending to have a stronger activity than AMRE. In addition, LTB₄, another chemical mediator generated through the 5-LOX-mediated metabolism of arachidonic acid in activated mast cells, was analyzed. In a previous study, we established a method to evaluate the inhibitory effects of food components on the production of LTB₄ using the PB-3c mast cell line (Takasugi et al., 2018). This enzymatic reaction involves lipid peroxidation, which is inhibited by antioxidants (Santangelo et al., 2007; Schneider et al., 2007; Yahfoufi et al., 2018). As shown in Fig. 2B and 2D, AMLE significantly inhibited the production of LTB₄ in stimulated PB-3c cells in a concentration-dependent manner, with AMLE exhibit a stronger activity than AMRE. The results shown in Fig. 1 and 2 suggest that the polyphenols with antioxidant properties in AMLE may contribute to its ability to inhibit chemical mediators.

During mast cell activation, Ca²⁺ influx from the endoplasmic reticulum into the cytosol is a crucial step in intracellular signal transduction, which facilitates the release of histamine and production of LTB₄. Therefore, measuring the changes in intracellular Ca²⁺ concentrations is essential to elucidate the antiallergic mechanisms of pharmaceuticals and food-derived bioactive compounds (Zhang et al., 2023). As shown in Fig. 3A, AMLE inhibited the stimulation-induced increase in the cytosolic Ca²⁺ concentration in RBL-2H3 cells in a concentration-dependent manner. Once Ca²⁺ influx occurs in stimulated mast cells, the arachidonic acid cascade is induced via 5-LOX reaction (Siraganian, 2003). To elucidate the mechanism underlying the inhibitory effect of AMLE on the production of LTB₄ in stimulated PB-3c cells, we examined the effects of AMLE on 5-LOX mRNA expression following cell stimulation. As shown in Fig. 3, AMLE suppressed Ca²⁺ influx and 5-LOX expression after stimulation, indicating that they are key contributors to its inhibitory effects on chemical mediators. During intracellular signaling within stimulated mast cells, a phosphorylation cascade of signaling molecules occurs upstream of Ca²⁺ influx (Gilfillan and Rivera, 2009). Future studies should examine the phosphorylation of signaling molecules to provide a more detailed mechanism underlying the inhibitory effects of AMLE on the release of chemical mediators.

The chemical mediators released by mast cells increase vascular permeability and promote the migration of other immune cells to the site of allergic reactions, subsequently inducing inflammatory responses wherein macrophages play a central role (Pal et al., 2020; Baran et al., 2023). Macrophages are activated when foreign substances (e.g., LPS) bind to TLRs on the cell membrane. This interaction triggers intracellular signaling pathways, which leads to the nuclear translocation of NF-κB and subsequent expression of inflammatory mediator synthases and inflammatory cytokines (Fatmawati et al., 2019; Pandya et al., 2022). We examined the effects of AMLE on LPS-stimulated inflammatory responses in macrophages to assess its anti-inflammatory effects. As shown in Fig. 4, AMLE significantly suppressed the release of the chemical mediators NO and PGE₂. Conversely, AMRE did not inhibit their release. Furthermore, AMLE significantly suppressed the mRNA (Fig. 5) and protein expression (Fig. 6B and 6D) of iNOS and mPGES-1, which are the key enzymes responsible for NO and PGE₂ synthesis, respectively, in stimulated macrophages. These results suggest that the inhibition of NO and PGE₂ release from LPS-stimulated RAW 264 cells by AMLE may result from the downregulation of these synthetic enzymes following stimulation. As shown in Fig. 7A and 7B, AMLE also significantly decreased the release of proinflammatory cytokines IL-1β and IL-6 in LPS-stimulated RAW 264 cells. Upon activation of macrophage intracellular signaling via TLR-mediated stimulation, the inhibitor of kappa B (IκB), which forms a complex with NF-κB, is degraded through phosphorylation and subsequent ubiquitination (Zhang et al., 2001; Israël, 2010). The freed NF-κB translocates into the nucleus, binds to the promoter regions of inflammation-related genes, and enhances their transcription, producing proteins that drive inflammatory processes. As shown in Fig. 7C, AMLE inhibited the nuclear translocation of NF-κB in stimulated macrophages. This finding suggests that the ability of AMLE to suppress inflammatory mediators and proinflammatory cytokines may be attributed to the inhibition of intracellular signaling pathways in macrophages. However, further research is needed to evaluate the effects of AMLE on IκB phosphorylation and ubiquitination to elucidate the specific mechanisms underlying its modulation of the NF-κB signaling pathway.

A. membranaceus leaves contain astragaloside IV and polyphenols, among which calycosin, kaempferol, quercetin, and their glycosides have the highest concentrations (Fu et al., 2014; Li et al., 2019). As described previously, AMLE is rich in polyphenols with antioxidant properties, potentially contributing to its inhibitory effects on allergic and inflammatory responses. To determine the active compounds that are responsible for these effects, we assessed the inhibitory activities of astragaloside IV, calycosin, kaempferol, and quercetin on the release of chemical mediators during allergic and inflammatory responses. As shown in Fig. 8, astragaloside IV showed no significant inhibitory effects on the release of chemical mediators from the stimulated immune cells in either the allergic or inflammatory models at 40 µM. Calycosin primarily inhibited PGE₂ release in LPS-stimulated RAW 264 cells. By contrast, kaempferol and quercetin exerted broad inhibitory effects, which significantly suppressed the release of all chemical mediators examined in allergic and inflammatory responses. Among them, quercetin displayed particularly strong inhibitory activity. Previous studies have reported the antiallergic properties of kaempferol (Lee et al., 2010) and quercetin (Mlcek et al., 2016; Zhang et al., 2023) and the anti-inflammatory activities of calycosin glycoside (Dong et al., 2018), kaempferol (Palacz-Wrobel et al., 2017; Wang et al., 2018; Li et al., 2023b), and quercetin (Endale et al., 2013; Wang et al., 2015), which are consistent with our findings. The results of quantitative analysis revealed that AMLE contains approximately 30 µmol/g of kaempferol and quercetin in aglycone equivalents. An effective concentration of 1 mg/mL of AMLE, which inhibits the release of chemical mediators in allergic and inflammatory responses, corresponds to approximately 30 µM of kaempferol and quercetin, which have been reported to possess significant antioxidant activity (Xu et al., 2019; Tian et al., 2021). These results suggest that the antiallergic and anti-inflammatory properties of AMLE are largely attributed to the combined effects of its major polyphenols, particularly kaempferol and quercetin, which exhibit strong antioxidant activities. Further research is needed to elucidate the mechanisms underlying the antiallergic and anti-inflammatory effects of these polyphenols in AMLE.

In conclusion, we found that AMLE effectively suppressed allergic and inflammatory responses. In particular, kaempferol and quercetin, which are the predominant polyphenols with antioxidant properties in A. membranaceus leaves, may play central roles by inhibiting intracellular signal transduction in immune cells. Based on these findings, A. membranaceus leaves could be used as a functional food for mitigating allergic and inflammatory symptoms. Future studies should use in vitro cell line models to elucidate the underlying mechanisms of AMLE. The relatively high concentrations of AMLE and its polyphenols used in this study reflect the experimental conditions under which immune cells were strongly stimulated, necessitating higher doses to achieve significant suppression of the response. To address this issue, in vivo studies using animal models are needed to evaluate the efficacy and safety of AMLE at lower doses. Such studies should also consider physiological factors, including digestion, absorption, biodistribution, and metabolism, to provide a more comprehensive understanding of the therapeutic potential of AMLE.

Supplementary materials can be found via https://doi.org/10.3746/pnf.2025.30.1.68

None.

The authors declare no conflict of interest.

Concept and design: HA. Analysis and interpretation: all authors. Data collection: PB, MN, AZ. Writing the article: PB, HA, MT. Critical revision of the article: HA, MT, CHF. Final approval of the article: all authors. Statistical analysis: PB, MT. Overall responsibility: HA.