Accounting for approximately 40% of the total body weight, the skeletal muscle is responsible for regulating metabolism and supporting physical activities (Frontera and Ochala, 2015). Sarcopenia, which is mainly associated with reduced muscle function in the elderly, not only interferes with the physical activities of daily life but also increases the risk of developing metabolic syndromes, including cardiovascular disease, diabetes, and hypertension (Lee et al., 2016a). In addition, as the skeletal muscle plays an important role in supporting bone strength and maintaining body posture, weakened sarcopenic muscles are closely linked to frequent falls and fractures in elderly individuals (Cederholm et al., 2013). Especially, sarcopenia was classified as a disease in the International Classification of Diseases, Tenth Revision, Clinical Modification Code in 2016 (Park et al., 2017). Thus, the importance of treatment and prevention for sarcopenia cannot be overstated.

The delicate balance between protein degradation and synthesis is an important determinant of muscle mass (Frontera and Ochala, 2015). Therefore, signal transduction related to protein synthesis and degradation has received considerable attention as a therapeutic target to prevent and inhibit muscle wasting and/or to increase the reduced muscle mass in the elderly (Sung et al., 2015; Park et al., 2017). In muscle cells, the phosphoinositide 3-kinase (PI3K)/Akt pathway represents a key cellular mechanism for improving sarcopenia, as it not only increases the rate of protein anabolism but also inhibits proteolysis (Wang et al., 2014; Sa et al., 2017). In terms of protein synthesis, the PI3K/Akt pathway stimulates the mammalian target of rapamycin (mTOR), which stimulates mRNA translation by phosphorylating two downstream factors: eukaryotic translation initiation factor 4E-binding protein 1 (4EBP1) and 70-kDa ribosomal protein S6 kinase (p70S6K) (Sa et al., 2017). Moreover, this pathway prevents the import of forkhead box O3a (FoxO3a) into the nucleus, where it works as a transcriptional factor to upregulate atrogin-1 and muscle ring finger 1 (MuRF1), which is predominantly involved in the ubiquitin-proteasome system (Wang et al., 2014).

Inflammatory responses and oxidative stress progressively stimulate the reduction in the protein content of the skeletal muscle by exceeding protein degradation to protein synthesis. Excessive oxidative stress not only modulates transcription factors, including FoxO3a and nuclear factor kappa B (NF-κB), but also stimulates the accumulation of damaged cellular molecules. DNA damage resulting from the overproduction of reactive oxygen species (ROS) induces mitochondrial dysfunction, reducing the ability of the mitochondria to relieve oxidative stress (Meng and Yu, 2010). In aged cells, the expression of interleukin (IL)-6 and tumor necrosis factor alpha (TNF-α) is highly increased, and the capacity of the antioxidant defense system is low, leading to an overstimulation of the inflammatory response and accelerating the protein degradation rate (Meng and Yu, 2010). In a previous study, TNF-α treatment excessively increased ROS production in L6 myotubes (Sa et al., 2017), thereby demonstrating that inflammatory responses and oxidative stress are not independent phenomena in atrophic skeletal muscle (Meng and Yu, 2010). However, several studies have suggested that chemical compounds, plant extracts, and phytochemicals possessing antioxidant and anti-inflammatory properties may be potential therapeutic candidates to inhibit several types of muscle atrophy, including sarcopenia (Dutt et al., 2015; Rondanelli et al., 2016).

Fingerroot [Boesenbergia pandurata (Roxb.) Schltr.], which belongs to Zingiberaceae, is an edible herb that has been used as a food ingredient. Fingerroot extract exhibits various biological activities, including anti-inflammatory, antioxidant, antibacterial, and anti-obesity properties (Eng-Chong et al., 2012). In particular, fingerroot extract was reported to increase the exercise capacity and skeletal muscle mass in mice (Kim et al., 2016). Panduratin A, a prenylated flavonoid that is known to be a major active compound in fingerroot (Chahyadi et al., 2014), attenuated muscle atrophy in TNF-α-treated L6 myotubes (Sa et al., 2017). Thus, fingerroot extract (B. pandurata extract, BPE) standardized with panduratin A may inhibit progressive muscle loss in the elderly. The present study aimed to demonstrate whether BPE can inhibit sarcopenia development by elucidating its underlying molecular mechanisms in aged rats.

Extract preparation

The dried rhizomes of fingerroot supplied by Phytomedi Inc. were extracted with 95% ethanol (v/v) and then filtered. The solvent in the filtrates was completely removed using a rotary evaporator (Heidolph Instruments GmbH) to obtain BPE (12.0%, w/w). BPE standardization was performed with panduratin A using a high-performance liquid chromatography system (Agilent Technologies) in accordance with a previously reported method (Kim et al., 2018b). The panduratin A content in BPE was 8% (w/w).

Animal experiment

Fischer 344 rats aged 11 weeks (Young) and 18 to 20 months (Aged) were supplied by the Central Lab Animal Inc. and the Laboratory Animal Resource Center (Korea Research Institute of Bioscience and Biotechnology), respectively. The animals were housed under the following well-controlled environments: 21°C±2°C, 50%±15% relative humidity, and a 12-h light/dark cycle at the KPC Laboratory. All rats had free access to water and food. Before starting oral administration, all rats were acclimated to the experimental conditions for 1 week, and the aged rats were assigned into two groups (n=8): aged group (Aged) and 200 mg/kg/d BPE-administered aged group (Aged+BPE). Meanwhile, the young rats were denoted as the Young group (Young). During the 8 weeks, the BPE group received BPE, whereas the other groups were treated with saline. The body weight of rats was measured once a week. After 8 weeks of oral administration, all rats were sacrificed by exsanguination under anesthesia. The weights of the gastrocnemius (GA), soleus (SOL), tibialis anterior (TA), extensor digitorum longus (EDL), and muscle tissues isolated from the left and right hindlimbs were measured.

The protocol for the animal experiment was reviewed and approved by the Institutional Animal Care and Use Committee of the Faculty of KPC Laboratory (permit No.: P170014).

Hematoxylin-eosin (HE) staining

Isolated GA muscle tissue was fixed in 10% formalin (Junsei) overnight, embedded in paraffin, and serially sliced for HE staining. To analyze the cross-sectional area (CSA) of the GA muscle tissue, images were captured using an inverted microscope (Olympus) equipped with the eXcope T500 camera (magnification, ×200; DIXI Science) and determined using ImageJ software (National Institutes of Health). The representative images from each group corresponding to the mean value of the CSA are shown.

Western blot analysis

Isolated GA muscle tissues were collected in different groups. After mixing with cold NP-40 lysis buffer (Elpis-Biotech) supplemented with a protease inhibitor cocktail (Sigma-Aldrich), the tissues were homogenized for 15 min and then centrifuged at 16,000 g for 15 min at 4°C. After separating the supernatant and debris, the protein concentration in the supernatant was measured using Bradford reagent (Bio-Rad). Next, equal amounts of proteins were mixed with 5× sample buffer (Elpis-Biotech) and denatured at 95°C for 5 min. The protein samples were loaded and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% to 20% gels and then transferred onto nitrocellulose membranes (Whatman), which were blocked in 10% nonfat milk for 2 h at room temperature. After washing with in Tris-buffered saline containing Tween 20 (TBST), the membranes were incubated with primary antibodies against FoxO3a, phosphorylated (p)-FoxO3a Thr32, PI3K, p-PI3K Tyr458, Akt, p-Akt Ser473, mTOR, p-mTOR Ser2448, p70S6K, p-p70S6K Thr389, 4EBP1, p-4EBP1 Thr37/46, and α-tubulin (1:1,000 dilution; Cell Signaling) overnight at 4°C. Subsequently, they were washed thrice with TBST for 10 min each and incubated with horseradish peroxidase-linked secondary antibodies (1:5,000 dilution; Bethyl Laboratories, Inc.) for 2 h at 4°C. An enhanced chemiluminescence reagent (Amersham Biosciences) was used to investigate the immunoreactivity. The visualization of the target proteins was performed using the G:BOX image analysis system (Syngene).

Reverse transcription-polymerase chain reaction

Total RNA was isolated from the collected GA tissues using TRIzol reagent (Takara). The concentration and purity of isolated RNA were measured using the NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific Inc.). RT premix (Elpis-Biotech) was used to convert RNA (2 mg) into cDNA. The reaction was conducted using the GeneAmp PCR System 2700 (Applied Biosystems) at 42°C for 55 min and then at 70°C for 15 min. cDNA was mixed with PCR premix (Elpis-Biotech) and specific primers (Bioneer). Thereafter, PCR amplification was performed. The primer sequences are shown in Table 1. The PCR cycle comprised 94°C for 30 s, 58°C to 61°C for 1 min, and 72°C for 1 min for 18 to 31 cycles, depending on the target. The PCR products were stained with the 5×Loading star (Dyne Bio) and then separated on a 1.5% agarose gel. The bands were visualized using the G:BOX image analysis system (Syngene).

Table 1 . Primer sequences for RT-PCR analysis.

Gene	Direction	Sequence (5’-3’)
MuRF1	Forward	ATGTCTGGAGGTCGTTTCCG
	Reverse	ACTGGAGCATTCCTGCTTGT
Atrogin-1	Forward	GTCCAGAGAGTCGGCAAGTC
	Reverse	GTCGGTGATCGTGAGACCTT
CAT	Forward	TGAGCCCAGCCCGGACAAGA
	Reverse	ACGCGAGCACGGTAGGGACA
SOD	Forward	GAGCATTCCATCATTGGCCG
	Reverse	CCAATCACACCACAAGCCAAG
TNF-α	Forward	CTCAAGCCCTGGTATGAGCC
	Reverse	TGGACCCAGAGCCACAATTC
IL-6	Forward	CCCAACTTCCAATGCTCTCCT
	Reverse	TAGCACACTAGGTTTGCCGA
β-Actin	Forward	CGAGTACAACCTTCTTGCAGCTC
	Reverse	CCAAATCTTCTCCATATCGTCCCAG

Enzyme-linked immunosorbent assay (ELISA)

Blood samples collected through cardiac puncture after anesthesia were maintained at room temperature for 1 h. After centrifugation at 4,000 g for 15 min, the serum was collected and stored at −70°C. The serum TNF-α and IL-6 levels were measured using the Rat TNF-α and IL-6 Quantikine ELISA Kit (R&D systems), respectively. In the final step, the absorbance at 540 nm was measured using the VersaMax Tunable Microplate Reader (Molecular Devices Inc.).

Antioxidant enzyme activities

Catalase (CAT) and superoxide dismutase (SOD) activities in GA muscle tissue were determined using the Catalase Activity Assay Kit (ab83464; Abcam) and the SOD Determination Kit (19160; Sigma-Aldrich), respectively. The absorbance at 570 nm for CAT activity or at 450 nm for SOD activity was measured using the VersaMax Tunable Microplate Reader (Molecular Devices Inc.).

Statistical analysis

Data are presented as the mean±standard deviation (SD). Group differences were assessed using one-way analysis of variance followed by Duncan’s multiple range test using SPSS 27.0 software (SPSS Inc.). Statistical significance was considered at P<0.05.

BPE increases skeletal muscle weight and muscle fiber size

Before we evaluated the effects of BPE on muscle atrophy in aged rats, we measured the body weight of rats for 8 weeks. A significant difference was observed between the young and aged groups. After 8 weeks of oral administration, the body weight was reduced by 5.52% and 6.12% in the Aged and Aged+BPE groups, respectively, compared with that at week 0. However, no significant difference was observed between the Aged and Aged+BPE groups (Fig. 1A).

Figure 1. Effects of Boesenbergia pandurata extract (BPE) on muscle weights and muscle fiber area. (A) Body weight of each group. (B) Weights of gastrocnemius (GA), soleus (SOL), tibialis anterior (TA), extensor digitorum longus (EDL) muscle tissues. (C) Representative images of GA muscle fibers (magnification, ×200). (D) Quantified cross-sectional area of GA muscle fibers. Values are presented as the mean±SD. ^##P<0.01 (vs. Young group); **P<0.01 (vs. Aged group).

After BPE treatment for 8 weeks, the GA, TA, EDL, and SOL muscle tissues isolated from the hindlimbs were weighed to determine whether sarcopenia was induced in aged rats. As the rats had different body weights, particularly between young and aged rats, the muscle weights were normalized to their own body weights. BPE treatment decreased the weights of the GA and TA muscle tissues in the Aged group by 22.04% and 13.61%, respectively, compared with those in the Young group. However, BPE treatment significantly increased the weights of the GA and TA muscles by 11.06% and 21.24%, respectively. In the case of the SOL and EDL muscle weights, significant differences between groups were not observed (Fig. 1B). Next, we assessed the CSA of the GA muscle tissue as GA accounted for the greatest portion of the hindlimb muscles and BPE significantly increased the GA muscle weight. BPE significantly increased the CSA of the GA muscle tissue, which decreased with aging (Fig. 1C and 1D).

BPE reduces protein-degradation-related factors and increases protein-synthesis-related factors

We investigated the molecular mechanism by which BPE increased GA muscle weight in aged rats, focusing on E3 ubiquitin ligases. The mRNA expression of atrogin-1 and MuRF1 was significantly higher in the Aged group than in the Young group. However, the oral administration of BPE significantly downregulated the mRNA expression levels (Fig. 2A). The protein expression of p-FoxO3a in the Aged group, which was lower than that in the Young group, was significantly recovered in the Aged+BPE group (Fig. 2B). Next, we investigated the PI3K/Akt and mTOR pathways to evaluate the relationship between BPE and protein synthesis. The protein expression of p-PI3K and p-Akt was significantly reduced in the GA muscle in the Aged group in comparison to those in the Young group. However, BPE treatment remarkably increased the protein expression of p-PI3K and p-Akt (Fig. 3A). Similar trends were observed in the protein expression levels of p-mTOR, p-p70S6K, and p-4EBP1. Oral administration of BPE in the aged GA muscle tissue markedly increased these protein expression levels which were downregulated in the Aged group (Fig. 3B).

Figure 2. Effects of Boesenbergia pandurata extract (BPE) on protein-degradation-related factors. (A) MuRF1 and atrogin-1 mRNA expression. Values were normalized to the expression of β-actin. (B) p-FoxO3a and FoxO3a protein expression levels. Values were normalized to the expression of the total form of FoxO3a. β-Actin and α-tubulin were used as loading controls. Total RNA and protein were isolated from gastrocnemius muscle tissues. Values are presented as the mean±SD (n=4 per group). ^#P<0.05, ^##P<0.01 (vs. Young group); *P<0.05, **P<0.01 (vs. Aged group).

Figure 3. Effects of Boesenbergia pandurata extract (BPE) on protein-synthesis-related factors. (A) p-PI3K, PI3K, p-Akt, and Akt protein expression levels. (B) p-mTOR, mTOR, p-p70S6K, p70S6K, p-4EBP1, and 4EPB1 protein expression levels. Values were normalized to the expression of the total form of each protein. α-Tubulin was used as a loading control. Protein was isolated from gastrocnemius (GA) muscle tissues. Values are presented as the mean±SD (n=4 per group). ^##P<0.01 (vs. Young group); **P<0.01 (vs. Aged group).

BPE activates antioxidant enzymes and decreases inflammatory cytokine production

Aging markedly downregulated the mRNA expression of CAT and SOD to less than 77.07% and 59.82% of those observed in the Young group, respectively, whereas these mRNA expression levels were upregulated in response to the oral administration of BPE (Fig. 4A). CAT and SOD activities were reduced by 70.67% and 27.27%, respectively, in the Aged group compared with those in the Young group. By contrast, BPE treatment remarkably increased the CAT and SOD activities by 322.73% and 28.72%, respectively, compared with those in the Aged group (Fig. 4B and 4C). The expression of TNF-α and IL-6 mRNA was significantly increased in the Aged group than in the Young group. However, BPE treatment decreased the increased those transcripts (Fig. 5A). The serum TNF-α and IL-6 levels in the Young group were 16.47±1.03 and 329.11±5.97 pg/mL, respectively. Aging increased the serum TNF-α and IL-6 levels by 29.93% and 23.62%, respectively. However, BPE treatment significantly reduced the levels of these inflammatory cytokines to those observed in the Young group (Fig. 5B and 5C).

Figure 4. Effects of Boesenbergia pandurata extract (BPE) on antioxidant enzymes. (A) Catalase (CAT) and superoxide dismutase (SOD) mRNA expression. Values were normalized to the expression of β-actin. β-Actin was used as a loading control. Total RNA and protein were isolated from gastrocnemius (GA) muscle tissues. (B) CAT and (C) SOD activities. Values are presented as the mean±SD (n=4 per group). ^#P<0.05, ^##P<0.01 (vs. Young group); *P<0.05, **P<0.01 (vs. Aged group).

Figure 5. Effects of Boesenbergia pandurata extract (BPE) on inflammatory cytokines. (A) Tumor necrosis factor alpha (TNF-α) and interleukin (IL)-6 mRNA expression. Values were normalized to the expression of β-actin. β-Actin was used as a loading control. Total RNA was isolated from gastrocnemius (GA) muscle tissues. (B) TNF-α and (C) IL-6 levels in the serum. Blood samples were collected through cardiac puncture. Values are presented as the mean±SD (n=4 per group). ^#P<0.05, ^##P<0.01 (vs. Young group); *P<0.05, **P<0.01 (vs. Aged group).

Sarcopenia or muscle loss in response to progressive aging has received considerable attention because of the increasing elderly population. The loss of muscle mass and protein content in muscle is closely related to skeletal muscle dysfunction, thereby representing a weakened ability to maintain posture; perform physical activities; and metabolize glucose, proteins, and fatty acids.

In the present study, we used rats aged 18 to 20 months, which is roughly equivalent to 45－50 years of age in humans (Sengupta, 2013). Muscle mass generally decreases by approximately 1% per year after the age of 30 (Volpi et al., 2004). Sarcopenia is commonly observed in healthy individuals from age 45 years, indicating that this disease typically begins around this age (Cherin et al., 2014). According to a previous study, the grip force and the ratio of GA muscle weight to body weight in 18- to 19-month-old Sprague-Dawley (SD) rats were significantly reduced compared with those in 5-month-old SD rats (Sung et al., 2015). Another study reported that the SOL muscle weight to body weight ratio was reduced in 18-month-old male Wistar rats than in 3-month-old male Wistar rats (Pansarasa et al., 2008). This finding is consistent with our results, wherein the GA and TA muscle weights were lower in the Aged group than in the Young group (Fig. 1B), indicating that sarcopenia had occurred in the aged rats employed in this study. Previously, our pharmacokinetic study demonstrated that the administration of BPE at 200 mg/kg resulted in the detection of panduratin A in the plasma and various organs of rats (Won et al., 2021). Because panduratin A exerted protective effects against muscle atrophy (Sa et al., 2017), we hypothesized that this dosage would also be effective in the current study. Moreover, a dose of 200 mg/kg/d of BPE for 8 weeks exhibited anti-inflammatory effects in the gingival tissues of Fischer 344 rats (Kim et al., 2018a), and BPE at the same dose exhibited a protective effect against ischemic stroke by activating astrocytes and inhibiting neuronal loss (Kongsui et al., 2019). These findings collectively suggest that a dose of 200 mg/kg/d is effective in mitigating inflammation and protecting tissues in animal models. Therefore, we orally administered BPE to rats at a dose of 200 mg/kg/d in the present study. BPE phenotypically recovered the GA and TA muscle weights and increased the CSA of the GA muscle tissue in aged rats (Fig. 1C and 1D). Consistent with these results, the daily administration of BPE at a dose of 200 mg/kg was shown to increase the GA skeletal muscle mass in normal and obese mice (Kim et al., 2016). These results suggest that BPE can help prevent and inhibit the development and progression of sarcopenia.

Several signaling pathways have been suggested as therapeutic targets for increasing the protein content in the skeletal muscle by decreasing protein catabolism and/or increasing protein anabolism (Park et al., 2017). Cell signaling via the PI3K/Akt pathway exerts a major effect in increasing the protein content. The hormone insulin-like growth factor-1 (IGF-1) stimulates muscle hypertrophy by upregulating the PI3K/Akt pathway (Bonaldo and Sandri, 2013). In IGF-1 receptor knockout mice, the PI3K/Akt pathway was remarkably inhibited together, and the number and area of myofibers were decreased (Mavalli et al., 2010). In the present study, BPE downregulated the MuRF1 and atrogin-1 transcripts and increased p-mTOR, p-p70S6K, and p-4EBP1 protein expression (Fig. 2A and 3B). In addition, BPE increased p-PI3K and p-Akt protein expression (Fig. 3A). Thus, with regard to the inhibitory effect of BPE on sarcopenia, BPE attenuated the aging-induced imbalance between protein synthesis and proteolysis in sarcopenic muscles by activating the PI3K/Akt pathway. BPE may have acted through another possible target protein to decelerate sarcopenia development. Mitochondria are major organelles in myocytes that regulate muscle function, particularly in energy production and protein metabolism (Kim and Hwang, 2020). Thus, mitochondrial homeostasis is important to maintain the number of mitochondria, and this process is controlled by two processes called mitochondrial biogenesis and mitophagy (Ju et al., 2016). Peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α) is a major biomarker for stimulating mitochondrial biogenesis, which consequently protects the skeletal muscle from sarcopenia and enhances muscle hypertrophy and exercise capacity (Kang and Li Ji, 2012; Correia et al., 2015). In a previous study, BPE increased the muscle mass, running time, and running distance by increasing PGC-1α expression in mice (Kim et al., 2016). To the best of our knowledge, little is known regarding the effects of BPE on autophagy or mitochondrial degradation related to muscle atrophy. However, panduratin A, a major compound in BPE, downregulated autophagy-related genes, including LC3b, Atg12, and Atg4b, in TNF-α-treated L6 myotubes (Sa et al., 2017). Therefore, although the PI3K/Akt pathway was demonstrated to be a signaling cascade associated with BPE-inhibited sarcopenic skeletal muscle, the increased PGC-1α expression and the reduced mRNA expression of autophagy-related genes might also be involved in the inhibitory effect on sarcopenia. The changes in the expression and activity of PGC-1α in response to BPE in aged muscles will be investigated together with the molecular mechanism in a further study.

In the present study, the expression and activity levels of antioxidant enzymes were highly suppressed in aged rats than in young rats (Fig. 4). Furthermore, the IL-6 and TNF-α levels in skeletal muscles and serum were higher in the Aged group than in the Young group (Fig. 5). These results support the evidence that sarcopenia is closely related to oxidative stress and inflammatory responses (Meng and Yu, 2010). Previous studies demonstrated that compounds or plant extracts with antioxidant or anti-inflammatory effects prevented muscle atrophy (Dutt et al., 2015; Rondanelli et al., 2016). Resveratrol, which is a natural polyphenol in red wine and grape skin, attenuated TNF-α-stimulated muscle atrophy by regulating the Akt pathway in C2C12 myotubes (Wang et al., 2014). Curcuma longa extract alleviated sarcopenia in aged mice by exerting anti-inflammatory effects and regulating the protein turnover pathways (Lee et al., 2021). BPE reportedly inhibited lipid peroxidation caused by free radicals in rat brain (Shindo et al., 2006) and reduced the levels of inflammatory molecules, including TNF-α, IL-5, IL-12, and IL-1β, in hairless mice (Kim et al., 2013). In particular, BPE inhibited the development of periodontitis, a gingival inflammatory disease, by decreasing NF-κB and IL-1β expression in aged rats (Kim et al., 2018a). The polyphenol compounds contained in BPE, including panduratin A, 4-hydroxypanduratin A, and boesenbergin A, have also been shown to possess antioxidant and anti-inflammatory properties (Chahyadi et al., 2014). In particular, panduratin A increased CAT and SOD mRNA expression and reduced ROS in muscle atrophy of TNF-α-treated L6 myotubes (Sa et al., 2017). In the present study, BPE treatment increased SOD and CAT expression and activities and decreased IL-6 and TNF-α levels in aged rats (Fig. 4 and 5). Thus, the antioxidant and anti-inflammatory properties of BPE partially contribute to its anti-atrophic effect on sarcopenic muscles. TNF-α and IL-6 are widely known as major inflammatory cytokines involved in the induction of muscle atrophy (Zhou et al., 2016). Aging is a systemic process that affects not only muscle tissues but also other organs, including the liver, where additional factors (e.g., C-reactive protein, IL-10, and IL-15) are implicated in sarcopenia (Wang et al., 2017). BPE has demonstrated anti-inflammatory responses in several models. BPE decreased IL-1β expression in gingival tissues (Kim et al., 2018b). In addition, BPE reduced immunoglobulin E and IL-4 levels in the serum of oxazolone-treated mice (Kim et al., 2013). It also reduced the prostaglandin E2 concentration in the lung tissues of hamsters (Kongratanapasert et al., 2023). Although the present study focused on the effects of BPE on TNF-α and IL-6 cytokines in serum and muscle tissues, other inflammatory markers might be positively affected by BPE in muscle tissues. These markers will be evaluated in a further study.

The prenyl group on a compound plays a positive and pivotal role in preventing muscle atrophy. In a previous study, 8-prenylnaringenin not only prevented muscle atrophy in denervation-treated mice by increasing Akt phosphorylation but also decreased atrogin-1 protein expression; however, naringenin did not show any effect on atrophic muscle. In particular, the amount of 8-prenylnaringein that accumulated in the skeletal muscle was higher than that of naringenin, indicating that the prenyl group aids the accumulation of prenylated compounds in the skeletal muscle (Mukai et al., 2012). Other prenylated phenol compounds, kazinol-P isolated from Broussonetia kazinoki and bakuchiol isolated from Psoralea corylifolia, promoted the differentiation of C2C12 myoblasts into myotubes, suggesting that these compounds are potential candidates for stimulating muscle regeneration and recovering atrophied muscles (Hwang et al., 2015; Lee et al., 2016b). Panduratin A increased PGC-1α mRNA expression in L6 muscle cells (Kim et al., 2011). In particular, it inhibited muscle atrophy by stimulating the PI3K/Akt pathway (Sa et al., 2017). As fingerroot contains a wide range of prenylated flavonoid compounds (Chahyadi et al., 2014), the inhibitory effect of BPE on sarcopenia may be because of the presence of phenolic compounds containing prenyl groups.

In the present study, BPE treatment significantly inhibited the development of sarcopenia in aged rats, as demonstrated by the increases in GA and TA muscle weights and the CSA of the GA muscle tissue. At the molecular level, BPE treatment stimulated the PI3K/Akt pathway, thereby increasing protein anabolism through the mTOR pathway and decreasing proteolysis through the inhibition of FoxO3a translocation. Furthermore, the antioxidant and anti-inflammatory activities of BPE were implicated in its anti-sarcopenic effects. To the best of our knowledge, no previous studies have investigated the anti-sarcopenic effects of BPE in aged rats. Although this study is limited by the use of a single dose of BPE and the absence of a positive control in evaluating the anti-sarcopenic effects of BPE, it may provide fundamental data for further studies on its potential anti-atrophic effects in aging muscle. Thus, these preclinical data can be used as a cornerstone to develop BPE as a natural agent or functional food ingredient against sarcopenia. However, clinical trials with the elderly should be scientifically supportive of the activities and safety of BPE for industrial application as an anti-muscle-wasting agent.

This research was partially supported by “The Project of Conversion by the Past R&D Results” through the Ministry of Trade, Industry and Energy (MOTIE) (N0002221, 2016).

The authors declare no conflict of interest.

Concept and design: CK, JKH. Analysis and interpretation: CK, MK. Data collection: CK, MK, YK. Writing the article: CK, MK. Critical revision of the article: JKH. Final approval of the article: all authors. Statistical analysis: MK, YK. Obtained funding: JKH. Overall responsibility: JKH.