Inflammation safeguards the body against internal and external stimuli, including pathogenic infections, allergic reactions, tissue damage, and psychological stress (Varela et al., 2018). Inflammatory responses play a vital role in the body’s ability to recover from injuries and infections (Ahmed, 2011). However, uncontrolled inflammation, which is triggered by several factors, adversely affects the anti-inflammatory pathways, resulting in slow, long-term chronic inflammation. Chronic inflammation is considered as a contributing factor in various diseases, including allergies, asthma, arthritis, cancer, and Alzheimer’s disease (Ahmed, 2011; Varela et al., 2018). Synthetic nonsteroidal anti-inflammatory drugs (NSAIDs) are well known for their analgesic, antipyretic, and anticancer properties. However, chronic NSAID use can cause side effects, including gastrointestinal bleeding, cardiovascular disease, kidney failure, and subarachnoid hemorrhagic stroke (Bindu et al., 2020). Thus, there is increasing interest in developing natural anti-inflammatory agents because of their potential efficacy and fewer adverse effects compared with synthetic drugs. Some examples of natural compounds that are known for their anti-inflammatory properties include flavonoids, antioxidant vitamins, polyphenols, dietary fibers, and omega-3 fatty acids (Haß et al., 2019).

Yuja (Citrus junos) is a citrus fruit from the Rutaceae family. It is predominantly grown in Korea, China, and Japan. Yuja contains an exceptionally high content of vitamin C, which is approximately three times higher than that of lemon (Citrus limon). This makes yuja a promising candidate for use in functional food and beverage products because of its potential health benefits (Lee et al., 2008). Moreover, yuja contains limonene (a fragrant component that exerts antibacterial, antioxidant, and anti-inflammatory effects) (Haß et al., 2019), dietary fiber, and flavonoids, with higher concentrations found in the peel than in the pulp (Lim et al., 2012). The main flavonoids present in yuja, including naringin and hesperidin, have been associated with numerous health benefits, including anti-allergy, anti-inflammatory, anticancer, antidiabetic, antihypertensive, and hypolipidemic effects, which can alleviate the components of metabolic syndrome (Li and Schluesener, 2017). Compared with ripe (yellow) yuja, unripe (green) yuja has higher levels of soluble dietary fiber, particularly pectin. Green yuja peel contains approximately 2.5－4 times more naringin and hesperidin than yellow yuja peel (Moon et al., 2015). Despite these known benefits, there is still insufficient research regarding the biological activities of green yuja peel.

Therefore, this study investigated the antioxidant and anti-inflammatory properties of green yuja peel extract and elucidated their underlying mechanisms using lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages.

Preparation of green yuja peel extract and naringin and hesperidin contents

Green yuja was harvested in October 2021 in Goheung, Jeonnam, Korea. The fruit was washed twice with water, and the peels were separated from the pulps. The peels were then dried and ground. Green yuja powder (100 g) was added to 900 mL of distilled water or 70% ethanol and extracted at 80°C. The extracted liquid was filtered using Whatman No.2 filter paper for 3 h and then concentrated under vacuum and freeze-dried. The yields of green yuja peel hot water extract (GYW) and ethanol extract (GYE) were 11.91% and 25.21%, respectively.

The naringin and hesperidin contents in GYW and GYE were determined in accordance with a previous study (Lee et al., 2023). Briefly, 1 g of GYW and GYE was mixed with 50 mL of methanol and sonicated for 20 min and then filtered. The naringin and hesperidin contents were analyzed using high-performance liquid chromatography (HPLC, Agilent, 1260B) equipped with a Zorbax Eclipse XDB C18 column (4.6 μm×250 mm, 5 mm). The mobile phase comprised acetonitrile, water, and formic acid at a ratio of 21:78.8:0.2 with a flow rate of 1 mL/min and an injection volume of 20 μL.

Cell culture

Murine RAW264.7 macrophage cell lines (KCLB No. 40071) were purchased from the Korean Cell Line Bank (KCLB). The cells were cultured in Dulbecco’s Modified Eagle’s Medium (Welgene) supplemented with 10% fetal bovine serum (Welgene) and 1% penicillin-streptomycin solution (Cytiva) in 5% CO₂ at 37°C. Cells at 60%－80% confluency were utilized for the experiments.

Cell viability

The cell viability of RAW264.7 cells was evaluated using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. The cells were seeded in 96-well plates at a density of 5×10⁴ cells per well and incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere. Subsequently, the cells were treated with or without 1 μg/mL of LPS (Sigma-Aldrich) for 1 h, followed by GYW or GYE at concentrations of 50, 100, or 200 μg/mL for 24 h. Vehicle cells were not treated with LPS, GYW, or GYE. After incubation, 50 μL of MTT reagent (Duchefa Biochemie) was added to each well and then incubated for 4 h. The culture medium was then removed, and 200 mL of dimethyl sulfoxide (Sigma-Aldrich) was added to each well. Formazan was dissolved at 37°C for 15 min, and the absorbance was measured at 595 nm using a microplate reader (Molecular Devices).

Nitric oxide (NO) production assay

RAW264.7 cells (5×10⁴ cells/well) were incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere in 96-well plates. The cells were treated with 1 μg/mL of LPS for 1 h and then with GYW or GYE at concentrations of 50, 100, or 200 μg/mL for 24 h. Next, 100 μL of supernatant was mixed with 100 μL of Griess reagent comprising 1% sulfanilamide in 5% phosphoric acid and 0.1% N-(1-naphthyl)ethylenediamine dihydrochloride. Then, the mixture was incubated at room temperature in the dark for 10 min, and the absorbance was measured at 550 nm using a microplate reader (Molecular Devices). The NO concentration was calculated by interpolation to a standard curve generated using sodium nitrite (Wako Chemicals) as a standard.

Measurement of proinflammatory cytokine levels

RAW264.7 cells (5×10⁴ cells/well) were incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere in 96-well plates. The cells were treated with 1 μg/mL of LPS for 1 h and then with GYW or GYE at concentrations of 50, 100, or 200 μg/mL for 24 h. Then, the culture medium was collected and assayed. The levels of proinflammatory cytokines, including tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), produced by RAW264.7 macrophages were measured by enzyme-linked immunosorbent assay (ELISA) using a DuoSet^Ⓡ ELISA kit (R&D Systems) in accordance with the manufacturer’s instructions.

Reactive oxygen species (ROS) production assay

ROS production in RAW264.7 macrophages was assessed using a modified 2’,7’-dichlorofluorescein diacetate (DCF-DA) assay (Kuznetsov et al., 2011). RAW264.7 cells (5×10⁴ cells/well) were incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere in a black 96-well plate. The cells were treated with 1 μg/mL of LPS for 1 h and then with GYW or GYE at concentrations of 50, 100, or 200 μg/mL for 24 h. The culture medium was aspirated from the well, and 200 μL of 10 μM DCF-DA was added to each well. The plate was then incubated at 37°C for 20 min. After washing the well with phosphate-buffered saline (PBS) twice, 200 μL of PBS was added to each well, and the fluorescence was subsequently measured using a microplate fluorescence reader (Molecular Devices) at excitation and emission wavelengths of 488 and 530 nm, respectively.

Total RNA isolation and real-time quantitative polymerase chain reaction (qPCR)

RAW264.7 cells (1×10⁶ cells/well) were seeded in six-well plates and incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere. The cells were treated with 1 μg/mL of LPS for 1 h and then with GYW or GYE at concentrations of 50, 100, or 200 μg/mL for 24 h. Total RNA was isolated from RAW264.7 cells using TRIzol^Ⓡ reagent (Invitrogen), and the RNA concentration was measured with a Nanodrop spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized using the SuperiorScript Ⅲ cDNA Synthesis Kit (Enzynomics) in accordance with the manufacturer’s instructions. The synthesized cDNA was used as a template for real-time quantitative polymerase chain reaction (RT-qPCR). Gene expression was analyzed using the CFX Duet Real-Time PCR System (Bio-Rad) with TOPreal^TM SYBR Green qPCR PreMIX (Enzynomics). The RT-qPCR primers for each gene were obtained from Bioneer, and the sequences of synthesized primers are presented in Table 1. The analysis procedure was conducted following the manufacturer’s instructions to obtain the threshold cycle (Ct) values. The gene expression results were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and calculated using the 2^−ΔΔCT method.

Table 1 . Primer sequences for RT-qPCR.

Gene name	Sequences of forward and reverse primer (5’-3’)		Tm (°C)
COX-2 (cyclooxygenase-2)	Forward	AGCCCATTGAACCTGGACTG	59.0
	Reverse	ACCCAATCAGCGTTTCTCGT
GAPDH (glyceraldehyde 3-phosphate dehydrogenase)	Forward	AAGGTCATCCCAGAGCTGAA	59.5
	Reverse	CTGCTTCACCACCTTCTTGA
IL-6 (interleukin-6)	Forward	AGTCCTTCCTACCCCAATTTCC	59.5
	Reverse	TGGTCTTGGTCCTTAGCCAC
IL-10 (interleukin-10)	Forward	TGCCTGCTCTTACTAACTGG	59.0
	Reverse	CTCTAGGAGCATGTGGCTCTG
iNOS (inducible nitric oxide synthase)	Forward	AGAACGGAGAACGGAGAACG	58.9
	Reverse	GAAGAGAAACTTCCAGGGGCA
TNF-α (tumor necrosis factor-α)	Forward	AAAGACACCATGAGCACAGAAAGC	62.0
	Reverse	GCCACAAGCAGGAATGAGAAGAG

RT-qPCR, real-time quantitative polymerase chain reaction; Tm, temperature..

Western blot analysis

RAW264.7 cells (1×10⁶ cells/well) were seeded in six-well plates and incubated for 12－20 h at 37°C in a 5% CO₂ atmosphere. The cells were treated with 1 μg/mL of LPS for 1 h and then with GYW or GYE at concentrations of 100 or 200 μg/mL for 24 h. After culture, the cells were lysed with lysis buffer comprising 50 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 2 mM ethylene glycol tetraacetic acid, 50 mM NaF, 1% Triton, 1 mM phenylmethylsulfonyl fluoride, 25 μL/mL leupeptin, and 2 μL/mL aprotinin and centrifuged at 16,810 g for 15 min at 4°C. The protein concentration of the supernatant was determined using the Bicinchoninic Acid Protein Assay Kit (Thermo Fisher Scientific). Protein samples (20 μg) were separated using 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (Cytiva). The membranes were probed with the primary antibodies of p-p65, phosphorylated nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-α (p-IκB-α), IκB-α, nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and β-actin (Santa Cruz Biotechnology) and inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2) (Cell Signaling Technology) overnight at 4°C and then incubated with secondary antibodies (Cell Signaling Technology) for 2 h. Subsequently, the protein bands were visualized using a SuperSignal^TM West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) followed by the use of a DAVINCH Chemi Fluoro Imager (Davinch-K). The amount of proteins was quantified by densitometric analysis using ImageJ software. β-actin was used to normalize the protein expression.

Statistical analysis

Data are presented as the means±standard error. Statistical analysis was conducted using the Statistical Package for the Social Sciences (SPSS version 27, IBM Corp.). One-way analysis of variance followed by Tukey’s honestly significant difference test was used for comparing groups. The naringin and hesperidin contents between GYW and GYE were compared using Student’s t-test. Statistical significance was considered at P<0.05. Pearson’s correlation coefficient was used to analyze the correlation between NO and ROS levels.

Naringin and hesperidin contents in green yuja peel hot water extract (GYW) and ethanol extract (GYE)

Using HPLC chromatography, the naringin and hesperidin contents of GYW were calculated as 4.47±0.01 and 10.96±0.18 mg/g, respectively, whereas those of GYE were measured as 8.00±0.03 and 17.27±0.87 mg/g, respectively. GYE contained higher naringin and hesperidin contents than GYW (Table 2).

Table 2 . Naringin and hesperidin contents.

	GYW	GYE
Naringin (mg/g)	4.47±0.01	8.00±0.03***
Hesperidin (mg/g)	10.96±0.18	17.27±0.87***

Data are presented as the mean±standard error obtained from three independent experiments..

***P<0.001 vs. GYW..

GYW, green yuja peel hot water extract; GYE, green yuja peel ethanol extract..

Effects of GYW and GYE on the viability of RAW264.7 macrophages

This study assessed the effects of GYW and GYE on the viability of RAW264.7 macrophages with and without LPS treatment. No cytotoxicity was observed at GYW and GYE concentrations of 50, 100, or 200 μg/mL regardless of LPS treatment when compared to vehicle-treated cells without LPS, GYW, or GYE treatment (Fig. 1A and 1B). Moreover, LPS at 1 μg/mL concentration did not exhibit cytotoxic effects on the macrophages (Fig. 1B).

Figure 1. Cell viability (A and B), NO production (C), and iNOS and COX-2 gene and protein expression (D and E). Data are presented as the mean±standard error obtained from three independent experiments. Values not sharing common letters (a-e) are significantly different among the groups at P<0.05. GYW, green yuja peel hot water extract; GYE, green yuja peel ethanol extract; LPS, lipopolysaccharide; NO, nitric oxide; iNOS, inducible NO synthase; COX-2, cyclooxygenase-2.

Effects of GYW and GYE on lipopolysaccharide (LPS)-stimulated NO production

LPS significantly increased NO levels to 15.75 μM compared with 0.08 μM in vehicle-treated cells, indicating that LPS-induced an excessive inflammatory response (Fig. 1C). However, GYW treatment at concentrations of 50, 100, and 200 μg/mL significantly reduced NO production by 38%, 77%, and 93%, respectively, compared with cells treated with LPS alone. Similarly, GYE treatment at concentrations of 50, 100, and 200 μg/mL significantly reduced NO production by 51%, 81%, and 97%, respectively, compared with cells treated with LPS alone. At the same concentrations, GYE appeared to be slightly more effective in inhibiting NO production than GYW (Fig. 1C) although the results were not statistically significant.

Effects of GYW and GYE on LPS-stimulated inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2) expression

The gene expression of iNOS and COX-2 was remarkably upregulated (increasing by 272-fold and 342-fold, respectively) in RAW264.7 macrophages stimulated with LPS compared with vehicle-treated cells (Fig. 1D and 1E). However, GYW and GYE treatment significantly downregulated iNOS and COX-2 expression in a dose-dependent manner compared with cells treated with LPS alone (Fig. 1D and 1E).

Furthermore, this study confirmed the effect of GYW and GYE on the expression of iNOS and COX-2 proteins at concentrations of 100 and 200 μg/mL using western blot analysis. Consistent with the gene expression results, the protein expression of iNOS and COX-2 was significantly upregulated in cells treated with LPS compared with vehicle-treated cells. However, GYW and GYE treatment effectively downregulated the protein expression of iNOS and COX-2 in a dose-dependent manner compared with cells treated with LPS alone (Fig. 1D and 1E).

Effects of GYW and GYE on the levels of proinflammatory cytokines and their genes in LPS-activated macrophages

LPS significantly increased the levels of proinflammatory cytokines IL-6 and TNF-α compared with vehicle-treated cells (Fig. 2A and 2B). However, GYW treatment at concentrations of 50, 100, and 200 μg/mL significantly reduced IL-6 levels by 27%, 41%, and 72%, respectively, and TNF-α levels by 22%, 38%, and 45%, respectively, compared with cells treated with LPS alone (Fig. 2A and 2B). Similarly, GYE treatment significantly decreased IL-6 and TNF-α levels (Fig. 2A and 2B). Furthermore, GYW and GYE significantly downregulated the gene expression of IL-6 and TNF-α in a dose-dependent manner compared with cells treated with LPS alone (Fig. 2C and 2D).

Figure 2. TNF-α and IL-6 levels (A, B) and their mRNA (C, D) expression, and IL-10 mRNA levels (E). Data are presented as the mean±standard error obtained from three independent experiments. Values not sharing common letters (a-f) are significantly different among the groups at P<0.05. IL-6, interleukin-6; LPS, lipopolysaccharide; GYW, green yuja peel hot water extract; GYE, green yuja peel ethanol extract; TNF-α, tumor necrosis factor-α; IL-10, interleukin-10.

Effects of GYW and GYE on IL-10 gene expression in LPS-activated macrophages

The gene expression of IL-10 significantly increased upon LPS treatment compared with vehicle-treated cells (Fig. 2E). However, GYW and GYE treatment at concentrations of 50, 100, and 200 μg/mL dose-dependently upregulated the gene expression of IL-10 compared with cells treated with LPS alone. Moreover, GYE tended to induce higher gene expression levels of IL-10 compared with GYW at concentrations of 100 and 200 μg/mL (Fig. 2E).

Effects of GYW and GYE on the nuclear factor kappa B (NF-κB) signaling pathway

Since LPS activates the NF-κB signaling pathway, this study aimed to determine the effects of GYW and GYE on NF-κB p65 and IκB-α protein levels in LPS-stimulated macrophages. Upon LPS treatment, NF-κB p65 and IκB-α phosphorylation increased by 35-fold and 4.7-fold, respectively, compared with vehicle-treated cells (Fig. 3), indicating that LPS-activated the NF-κB signaling pathway. However, GYW and GYE treatment at concentrations of 100 and 200 μg/mL significantly downregulated the protein expression of phosphorylated NF-κB p65 and IκB-α compared with cells treated with LPS alone (Fig. 3). Thus, the green yuja peel extracts inhibited the NF-κB signaling pathway that was upregulated by LPS.

Figure 3. p-p65 and p-IκB-α protein expression. Data are presented as the mean±standard error obtained from three independent experiments. The protein expression was calculated as the fold-change relative to the vehicle group. Values not sharing common letters (a-c) are significantly different among the groups at P<0.05. p-IκB-α, phosphorylated nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-α; LPS, lipopolysaccharide; GYW, green yuja peel hot water extract; GYE, green yuja peel ethanol extract; p-NF-κB, phosphorylated nuclear factor kappa-B.

Effects of GYW and GYE on LPS-induced ROS production and the nuclear factor erythroid 2-related factor 2 (Nrf2) / heme oxygenase-1 (HO-1) system

ROS levels were notably elevated in the cells treated with LPS compared to those treated with the vehicle. However, treatment with GYW and GYE at concentrations of 50, 100, and 200 μg/mL resulted in a substantial reduction in ROS levels in a concentration-dependent manner compared to cells treated with LPS only (Fig. 4A). This study identified a positive correlation between ROS (Fig. 4A) and the NO (Fig. 1C) levels (r=0.935, P<0.01) (Fig. 4B), indicating that LPS-induced ROS increase NO. LPS causes a marked reduction in the expression of Nrf2 and HO-1 proteins compared with vehicle-treated cells. However, GYW and GYE treatment significantly upregulated the Nrf2/HO-1 system compared with cells treated with LPS only (Fig. 4C and 4D).

Figure 4. Correlation between NO and ROS levels (A), ROS levels (B), and protein expression of Nrf2 (C) and HO-1 (D). Data are presented as the mean±standard error obtained from three independent experiments. Values not sharing common letters (a-d) are significantly different among the groups at P<0.05. ROS, reactive oxygen species; NO, nitric oxide; LPS, lipopolysaccharide; GYW, green yuja peel hot water extract; GYE, green yuja peel ethanol extract; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1.

This study investigated the anti-inflammatory effects of GYW and GYE using RAW264.7 macrophages treated with LPS. LPS-stimulated RAW264.7 macrophages are commonly used to assess the effects of anti-inflammatory agents because of their ability to produce NO as part of the inflammatory response. Excessive NO production is implicated in inflammatory and autoimmune diseases, and the inhibition of NO production is considered as an indicator of anti-inflammatory effects (Semenikhina et al., 2022). The present study demonstrated that GYW and GYE protected against LPS-induced NO production at concentrations of 50, 100, and 200 μg/mL in LPS-treated RAW264.7 macrophages without causing cytotoxicity. NO is synthesized from L-arginine by three distinct enzymes: neuronal NOS, endothelial NOS, and iNOS. Among them, iNOS is expressed in macrophages in response to LPS or cytokines, produces NO, and participates in inflammatory responses (Singh and Gupta, 2011). In this study, GYW and GYE significantly inhibited the expression of iNOS and the associated protein, which was increased by LPS, in a dose-dependent manner. In a previous study, Kim et al. (2014) also reported that a 70% ethanol extract of yellow yuja peel (200－1,200 μg/mL) significantly reduced NO production by inhibiting iNOS expression in LPS-induced RAW264.7 macrophages. The green yuja peel extract (50－200 μg/mL) used in this experiment effectively suppressed the NO content produced by LPS at concentrations lower than that of yellow yuja peel extract in Kim et al.’s study. Based on an earlier report wherein NO production was decreased in mice treated with iNOS inhibitors (Cinelli et al., 2020), these results suggest that the inhibitory impact of GYW and GYE on iNOS protein expression in LPS-induced macrophages contributes to the decrease in NO production. Furthermore, GYW and GYE effectively reduced COX-2 gene and protein levels compared with cells treated with LPS alone. COX is an enzyme involved in inflammation and exists in two isoforms: COX-1 and COX-2. COX-1 plays a role in producing protective substances in the stomach, intestine, and kidney and maintains the homeostasis of normal cells, whereas COX-2 is produced in response to LPS and cytokines (Stiller and Hjemdahl, 2022). A previous study has shown that naringin (10－40 μg/mL), a compound found in citron, inhibited the expression of iNOS and COX-2 genes in LPS-treated RAW 264.7 macrophages (Liu et al., 2022). The naringin content of GYW and GYE was 4.47±0.01 and 8.00±0.03 mg/g, respectively. Therefore, the naringin content used in this study was an effective dose. Interestingly, although GYE contained higher naringin and hesperidin contents (2- and 1.7-fold higher, respectively) than GYW, they had similar effects in decreasing NO levels. Future studies should compare ingredients other than naringin and hesperidin to determine the reason behind this.

TNF-α and IL-6 are inflammatory cytokines released by immune cells, such as leukocytes, macrophages, and lymphocytes. TNF-α is primarily produced in response to inflammatory stimuli and can lead to chronic inflammation when it is overproduced. On the other hand, IL-6 plays a role in inducing the production of proteins associated with acute inflammatory responses during the early stages of the immune response (Zhang and An, 2007). Therefore, TNF-α and IL-6 inhibitors are used as treatments for chronic inflammatory and autoimmune diseases (Hira and Sajeli Begum, 2021). Here, GYW and GYE significantly downregulated the gene expression of IL-6 and TNF-α induced by LPS in a dose-dependent manner, leading to a decrease in the relevant proteins in macrophages. These findings are in line with previous findings, demonstrating the ability of citrus fruits in suppressing TNF-α and IL-6 levels (Shin et al., 2011). Conversely, we found a significant dose-dependent elevation in the gene expression of the anti-inflammatory cytokine IL-10 in the GWE and GYE groups compared with macrophages treated with LPS alone. In macrophages, IL-10 is produced in response to adiponectin-mediated immune response and acts to inhibit the progression to chronic inflammation by blocking the NF-κB signaling pathway (Rahim et al., 2005). Therefore, we further investigated the effects of GYW and GYE on the NF-κB signaling pathway.

The NF-κB signaling pathway is a central regulator of inflammation. Upon activation by LPS, IκB is phosphorylated and subsequently dissociated. This process results in the translocation of NF-κB dimers (p65 and p50) from the cytoplasm to the nucleus, where they promote the expression of iNOS, COX-2, and proinflammatory cytokines (Dorrington and Fraser, 2019). Saiprasad et al. (2013) demonstrated that hesperidin significantly reduced iNOS and COX-2 expression by inhibiting the NF-κB signaling pathway in mice with azoxymethane-induced colon cancer. Naringin has also been shown to inhibit the expression of iNOS, COX-2, TNF-α, and IL-6 genes and NO production by inhibiting the NF-κB signaling pathway in macrophages exposed to LPS (0.01, 0.1, and 1 μg/mL) (Kanno et al., 2006). In the present study, GYW and GYE significantly downregulated IκB and NF-κB p65 phosphorylation compared with cells treated with LPS only. These findings indicated that the suppressive effect of GYW and GYE on the production of NO and proinflammatory cytokines induced by LPS may be mediated through the suppression of the NF-κB signaling pathway.

The increase in ROS production can activate the inflammatory pathways in response to inflammatory agonists, including IL-1β, TNF-α, and LPS. ROS serve as signaling mediators for specific inflammatory agonists, contributing to the initiation and amplification of inflammatory responses (Forrester et al., 2018). The present study also confirmed the positive correlation between ROS and NO levels in LPS-stimulated macrophages. LPS activates NADPH oxidase, leading to the excessive production of ROS in the mitochondria of macrophages, which in turn activate the NF-κB signaling pathway (Sul and Ra, 2021). A previous study demonstrated that nobiletin, a compound derived from citrus peel, suppresses iNOS and COX-2 expression by decreasing ROS production and inhibiting the DNA binding activity of NF-κB in LPS-stimulated RAW264.7 macrophages (Choi et al., 2007). Moreover, limonene, an essential oil component of citron, inhibited ROS production and the NF-κB signaling pathway in eosinophilic leukemia HL-60 clone 15 cells (Hirota et al., 2010). The reduction of ROS levels upon GYW and GYE treatment suggests a potential mechanism by which these extracts inhibit NO production in LPS-stimulated macrophages. Since ROS production can activate the NF-κB signaling pathway, leading to increased NO production, the suppression of ROS by GYW and GYE may lead to the suppression of NF-κB activation and a subsequent reduction in NO levels. Moreover, we observed an elevation in the protein expression of Nrf2 and its downstream antioxidant enzyme HO-1 in a concentration-dependent manner following treatment with GYW and GYE. Nrf2 is a transcription factor that is essential for cellular defense mechanisms against oxidative stress. It achieves this by controlling the expression of various antioxidant and detoxification enzymes (He et al., 2020). Consistent with our findings, a previous study showed that Nrf2 expression was downregulated upon stimulation of RAW264.7 macrophages with LPS (1 μg/mL) (Li et al., 2020). These findings suggest that LPS-induced inflammation may suppress the Nrf2/HO-1 system, leading to reduced antioxidant defense and increased oxidative stress. HO-1, a cytoprotective enzyme, exerts anti-inflammatory and antioxidative effects (Zhao et al., 2020). Therefore, GYW and GYE attenuated LPS-induced oxidative stress by upregulating the Nrf2/HO-1 system, which subsequently suppressed NF-κB signaling-induced inflammation.

In conclusion, GYW and GYE exhibited anti-inflammatory and antioxidative stress properties by downregulating the NF-κB signaling pathway and upregulating the Nrf2/HO-1 system in LPS-stimulated macrophages. This dual mechanism of action highlights the potential of GYW and GYE as therapeutic agents for mitigating inflammation and oxidative stress-related conditions.

None.

The authors declare no conflict of interest.

Concept and design: MKL, HIL. Analysis and interpretation: SK, SYC, MKL. Data collection: SK, SYC. Writing the article: SK, SYC, MKL. Critical revision of the article: MKL. Final approval of the article: all authors. Statistical analysis: SK, SYC. Overall responsibility: MKL.