전체메뉴
Article Search

PNF Preventive Nutrition and Food Science

Open Access


ISSN 2287-8602
QR Code QR Code

Original

Article

Original

Prev Nutr Food Sci 2023; 28(3): 255-262

Published online September 30, 2023 https://doi.org/10.3746/pnf.2023.28.3.255

Copyright © The Korean Society of Food Science and Nutrition.

Effects of Mealworm Fermentation Extract and Soy Protein Mix Ratio on Hepatic Glucose and Lipid Metabolism in Obese-Induced Mice

Ra-Yeong Choi1 , Mi-Kyung Lee2

1Department of Agricultural Biology, National Institution of Agricultural Sciences, Rural Development Administration, Jeonbuk 55365, Korea
2Department of Food and Nutrition, Sunchon National University, Jeonnam 57922, Korea

Correspondence to:Mi-Kyung Lee, E-mail: leemk@scnu.ac.kr

Received: March 27, 2023; Revised: May 30, 2023; Accepted: June 20, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Previous studies found that mealworm fermentation extract (TMP) reduced alcoholic hepatic steatogenesis. This study examined how the ratio of TMP and soy protein (SP) mix affected glucose and lipid metabolism in obese mice given a high-fat diet (HFD). Mice were given HFD supplemented with 100% SP or the following three ratios of TMP and SP mix for 12 weeks: 20% (S4T1), 40% (S3T2), and 60% (S2T3) TMP. When compared to the SP group, the S2T3 group had considerably lower body weight gain and food consumption. When compared to the SP group, the S2T3 group had slightly lower blood insulin and leptin levels, as well as a lower homeostasis model assessment of insulin resistance score. The use of TMP instead of SP reduced the size of epididymal adipose tissue cells. An increase in the extent of substitution of SP with TMP inhibited the gene expression of hepatic fructolysis/gluconeogenesis (KHK, ALDOB, DLD, and FBP1), lipogenesis (FAS, SCD1, CD36, and DGAT2), and its transcriptional factors (PPARγ and ChREBP). Furthermore, the S2T3 group dramatically reduced the expression of hepatic genes implicated in endoplasmic reticulum stress (PDI) and antioxidant defense (SOD1). The 60% TMP mix, in particular, reduced the expression of hepatic glucose and lipid metabolismrelated genes in HFD-fed mice. The manufacturing of functional processed goods may be accomplished by combining SP and TMP in a 2:3 ratio.

Keywords: fatty liver, high-fat diet, lipid metabolism, soybean protein, Tenebrio molitor

INTRODUCTION

Obesity and its associated comorbidities, such as type 2 diabetes, cardiovascular disease, hypertension, and cancer have increased worldwide (Drummen et al., 2018). Carbohydrate response element-binding protein (ChREBP) plays a crucial role in the development of non-alcoholic fatty liver disease (NAFLD), glucose intolerance, dyslipidemia and cancer, and controls the transcription of genes involved in glucose and lipid metabolism, impacting these clinical diseases (Iizuka, 2017). Controlling dietary protein consumption has recently been identified as a viable method for reducing obesity (Ijaz et al., 2018). A prior meta-analysis found that an isocaloric high-protein diet is superior to a conventional protein diet in terms of weight reduction, body composition, and management of resting energy expenditure (Wycherley et al., 2012). Indeed, casein has been employed as the only protein component in the majority of commercially purified diets for obesity (Choi et al., 2021). Soy protein (SP) is classified as a complete protein as it includes the majority of the necessary amino acids present in animal protein and is approximately similar to high-biological-value animal protein (Velasquez and Bhathena, 2007). Torre-Villalvazo et al. (2008) found that long-term (180-day) SP treatment had positive effects on the liver and adipose tissue in rats, even when given a high-fat diet (HFD).

Tenebrio molitor larva (mealworm) is a nutritious edible insect that provides essential amino acids, polyunsaturated fatty acids, trace elements, and vitamins (Feng, 2018). Gessner et al. (2019) reported that isonitrogenous substitution of 50% and 100% of casein with mealworm meal had lipid-lowering benefits in a hyperlipidemic rat model. The purpose of this study was to see how different ratios of mealworm fermentation extract (TMP) and SP mix (20, 40, or 60% TMP) affected hepatic glucose and lipid metabolism-related gene expression in HFD-induced obese mice.

MATERIALS AND METHODS

Animals and diets

Male C57BL/6N mice aged 4 weeks (n=40) were bought from Orient Bio Inc., and kept under normal circumstances (22±2°C, 50±5% humidity, and a 12-h light/dark cycle). The Sunchon National University’s Institutional Animal Care and Use Committee (SCNU_IACUC_2020-08) gave its approval to the protocol. The mice were divided into 4 groups of 10 mice each after a week of acclimatization. The mice were given HFD supplemented with SP (Shandong Yuxin Bio-Tech Co., Ltd.) as the control or three concentrations of TMP (20, 40, and 60%) and SP mix (S4T1, S3T2, and S2T3), each of which included 20% protein sources, in three different ratios. Table 1 contains a list of the experimental diets and their ingredients. The mice have limitless access to food and water at all times. Three times a week, the diet was modified, and once a week, the body weight was recorded. The overnight-starved mice were put to death with inhalation after the 12-week trial, and blood was taken from the inferior vena cava as described in our prior work (Ham et al., 2021). In preparation for further examination, the liver and white adipose tissues (WAT) were extracted and kept at −80°C. For histological investigation, certain tissue samples were fixed in 10% neutral buffered formalin. According to the preceding instructions, the TMP was extracted (Choi et al., 2020a). In the yeast extract–peptone–dextrose medium, defatted and freeze-dried mealworm powder was used to replace peptone. After being infused into the broth, the Saccharomyces cerevisiae strain (KCTC 17299) from the Korean Cell Line Bank was incubated for 72 h at 32±3°C. The yeast/mealworm fermentation broth (1 L) was then extracted with 1 L of fermented alcohol at a 70% concentration. The sample extractions underwent filtering, evaporation, and freeze-drying.

Table 1 . Dietary composition in experiments1).

Ingredients (%)SPS4T1S3T2S2T3
SP20.016.012.08.0
TMP4.08.012.0
DL-methionine0.30.30.30.3
Choline bitartrate0.20.20.20.2
Corn starch34.034.034.034.0
Sucrose15.015.015.015.0
Cellulose5.05.05.05.0
Corn oil3.03.03.03.0
Lard18.018.018.018.0
Mineral mixture2)3.53.53.53.5
Vitamin mixture3)1.01.01.01.0

1)Experimental diets were adjusted ratio for protein contents..

2)Mineral mixture according to AIN-76..

3)Vitamin mixture according to AIN-76..

SP, soy protein; TMP, mealworm fermentation extract..



Serum biochemical assays

Using an assay kit, the glucose level was determined (Asan Pharmaceutical Co., Ltd.). Enzyme-linked immunosorbent assay kits from R&D Systems, Inc. and Morinaga Institute of Biological Science, Inc. were used to measure the levels of leptin and insulin, respectively. The equation fasting insulin (μIU/mL)×fasting glucose (mmol/L)/22.5 was used to calculate the homeostasis model assessment of insulin resistance (HOMA-IR).

Histological analysis

Hematoxylin and eosin (H&E) staining was performed on the paraffin-embedded fixed liver and epididymal WAT. Oil Red O was used to stain the liver slices. A 200× optical microscope was used to magnify the tiny pictures for observation.

RNA isolation and reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis

The total RNA was isolated using the TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc.). RNA content was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Complementary DNA synthesis was performed using a ReverTra Ace qPCR RT master mix (Toyobo). The RT-qPCR analysis was conducted using the CFX96 Touch™ real-time PCR detection system (Bio-Rad Laboratories, Inc.) with an SYBR green PCR kit (Qiagen). The primer details can be found in Table 2.

Table 2 . Primer sequences for quantitative real-time polymerase chain reaction based on reverse transcription.

GeneNameForward/reverse (5’-3’)
ALDOBFructose bisphosphate aldolase BGCTGTGTTGAGGATTGCTGA/TAGACAGCAGCCAGGACCTT
CD36Cluster of differentiation 36GCTGTCAGGCGTCAGGATAA/TGGCTTCAGGGAGACTGTTG
ChREBPCarbohydrate-response element-binding proteinCTGGGGACCTAAACAGGAGC/GAAGCCACCCTATAGCTCCC
DGAT2Diacylglycerol O-acyltransferase 2CTGGCTGATAGCTGCTCTCTACTTG/TGTGATCTCCTGCCACCTTTC
DLDDihydrolipoyl dehydrogenaseCCTTGTAGCTACGGGCTCAG/CCCACATGACCCAAAAATTC
FASFatty acid synthaseTTGGAGCTAAGGCATGGTGG/GCAGTTGTCCTCTGGATGCT
FBP1Fructose-1,6-bisphosphatase 1GTCTGTTTCGATCCCCTTGA/GTCCAGCATGAAGCAGTTGA
GAPDHGlyceraldehyde-3-phosphate dehydrogenaseAAGGTCATCCCAGAGCTGAA/CTGCTTCACCACCTTCTTGA
KHKKetohexokinaseTCGAGTGAAGAAAGGGGCTA/CCTTCGAGAGGCTGAAGATG
PAPPhosphatidate phosphatase 1GGGTTCTACTGTGGAGATGA/TGACAGTAGCTGTGATGATGA
PDIProtein disulfide isomeraseTATGATGGGCCTAGGACTGC/TGCTGGCTGCTTTTAGGAAT
PPARγPeroxisome proliferator-activated receptor gammaTCGCTGATGCACTGCCTATG/GAGAGGTCCACAGAGCTGAT
SCD1Stearoyl-CoA desaturaseTTCTTCATCGACTGCATGGC/ACTCAGAAGCCCAAAGCTCAG
SOD1Superoxide dismutase 1CCAGTGCAGGACCTCATTTT/TTGTTTCTCATGGACCACCA
SREBP-1cSterol regulatory element-binding protein 1cAACCTCATCCGCCACCTG/TGGTAGACAACAGCCGCATC


Statistical analysis

Statistical analysis was performed using IBM SPSS software (version 20, IBM Corp.). The data are presented as mean±standard error. One-way ANOVA was utilized to determine significant differences among the groups, followed by Tukey’s test. Statistical significance was considered at a threshold of P<0.05.

RESULTS

Body weight, food intake, and insulin resistance index

There were no significant changes in weekly body weights for the first 9 weeks. However, after 10 weeks on the experimental diet, the body weights in the S2T3 group showed a trend toward being lower compared to the SP, S4T1, and S3T2 groups (Table 3). By the 12th week, the S2T3 group exhibited a significantly reduced body weight gain compared to the other groups (Table 3). Furthermore, the S2T3 group demonstrated a significant decrease in food intake compared to the SP group (Table 3). Serum glucose levels did not show significant statistical changes among the four groups (Table 3). Nevertheless, the serum insulin and leptin levels, as well as the HOMA-IR index, tended to be reduced in the S2T3 group compared to the SP group (Table 3).

Table 3 . Obese mice given high-fat diets with a TMP/SP mix had different body weights, food intakes, serum glucose, insulin, and leptin levels, and HOMA-IR.

SPS4T1S3T2S2T3
Body weights (g)
0 week19.20±0.3319.53±0.2419.53±0.2419.54±0.24
3 week26.07±0.2626.19±0.5725.85±0.2925.40±0.38
6 week31.79±0.5132.67±0.9832.16±0.5531.22±0.63
9 week37.81±0.7138.83±1.2237.32±0.7935.17±0.71
10 week39.49±0.76ab40.66±1.27b39.25±0.95ab36.65±0.78a
11 week40.65±0.82ab41.71±1.23b40.77±0.94ab37.67±0.80a
12 week41.23±0.82ab42.41±1.16b41.92±0.94ab38.41±0.82a
Body weight gain (g)22.02±0.59b22.87±1.04b22.39±0.77b18.93±0.77a
Food intakes (g/d)3.93±0.05b3.71±0.05ab3.70±0.08ab3.45±0.07a
Serum glucose (mmol/L)14.10±1.6314.96±1.1512.99±1.0310.52±0.69
Serum insulin (μIU/mL)100.53±26.93ab153.37±33.27b132.20±21.30ab51.27±8.70a
Serum leptin (ng/mL)7.23±1.23ab8.57±1.04b7.58±0.80ab4.46±0.78a
HOMA-IR68.18±21.59ab97.57±20.04b79.84±17.00ab25.49±5.45a

The data are shown as mean±SE. Means with distinct letters (a,b) in a row show statistically significant differences between groups..

TMP, mealworm fermentation extract; SP, soy protein; HOMA-IR, homeostasis model assessment of insulin resistance..



Morphological changes in the adipose tissue and liver

The histological examination of epididymal WAT stained with H&E revealed that the adipocyte size was smaller in proportion to the substitution ratio of TMP replacing SP (Fig. 1). In the histological analysis of hepatic tissues using H&E staining, the SP group exhibited a noticeable increase in fat vacuoles, while the TMP-replacement groups (S4T1, S3T2, and S2T3) showed fewer lipid droplets (Fig. 1). The presence of Oil Red O-positive lipid droplets in the SP group was observed throughout the liver, whereas increasing the TMP-replacement ratio resulted in reduced lipid accumulation compared to the SP group (Fig. 1).

Figure 1. Histological appearance of epididymal white adipose tissue and liver in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Magnification: 200×. H&E, hematoxylin and eosin.

Changes in expression of gene controlling hepatic fructolysis/gluconeogenesis

Fig. 2 demonstrates that the gene expression of KHK and ALDOB was significantly suppressed when TMP substitution levels exceeded 60%. Similarly, the gene expression of DLD and FBP1 was down-regulated with increasing substitution of SP by TMP (Fig. 2). Notably, these four genes exhibited a pronounced down-regulation in the S2T3 group compared to the SP group.

Figure 2. Gene expression related to hepatic fructolysis/gluconeogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.

Changes in expression of gene controlling hepatic lipogenesis

In relation to fatty acid synthesis, the gene expression of FAS and SCD1 was significantly down-regulated at TMP-replacement levels exceeding 40% and 60%, respectively, compared to the SP group (Fig. 3). In addition, the mRNA expression of the fatty acid uptake-related gene CD36 was significantly decreased in the S3T2 and S2T3 groups compared to the SP group (Fig. 3). While the expression of PAP was lower in the TMP-replacement groups, no significant differences were observed (Fig. 3). Furthermore, the mRNA levels of the triglyceride synthesis gene DGAT2 were significantly down-regulated in the S4T1, S3T2, and S2T3 groups compared to the SP group (Fig. 3).

Figure 3. Gene expression related to hepatic lipogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a,b) above the bars indicate significant differences among the groups.

Changes in expression of hepatic transcription factor genes

The mRNA levels of glucose and lipid metabolism-related transcription factors were measured (Fig. 4). The PPARγ gene expression in the S2T3 group was significantly lower than in the SP group. As the addition ratio of TMP increased, the ChREBP gene expression in the TMP-replacement groups was down-regulated compared with the SP group. The TMP replacement did not affect the SREBP-1c gene expression.

Figure 4. Gene expression of hepatic transcription factors in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups. 

Changes in expression of hepatic endoplasmic reticulum (ER) stress and antioxidant gene expression

Major indicators of ER-related stress and antioxidants, respectively, are PDI and SOD1. In a dose-dependent manner, the expression levels of the PDI and SOD1 genes were reduced in the TMP-replacement groups in comparison to the SP group (Fig. 5).

Figure 5. Gene expression of hepatic endoplasmic reticulum stress and antioxidant-related genes in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.

DISCUSSION

We previously reported that glutamic acid, leucine, and alanine were the most prevalent amino acids in TMP (Choi et al., 2020b). Zhang et al. (2007) discovered that dietary leucine supplementation decreases HFD-induced hypercholesterolemia, hyperglycemia, and adiposity in rodents. L-alanine or L-arginine administration has been found to reduce obesity and glucose intolerance in mice induced to be obese by monosodium glutamate (Araujo et al., 2017). Glutamine supplementation decreases adipose mass and enhances insulin sensitivity in HFD-fed Wistar rodents, according to Abboud et al. (2019). The present study demonstrated that as the ratio of TMP to SP in the mixture increased, the expression of genes implicated in ChREBP-mediated glucose and lipid metabolism improved in NAFLD. Specifically, the 60% ratio by TMP (S2T3 group) substantially decreased the KHK and ALDOB genes relative to the SP group. Shepherd et al. (2020) reported that KHK catalyzes fructose into fructose-1-phosphate, which is then cleaved by ALDOB into glyceraldehyde and dihydroxyacetone-phosphate. Triokinase converts glyceraldehyde to glyceraldehyde 3-phosphate, which is then converted to glucose by gluconeogenesis or further metabolized into acetyl-CoA, resulting in lipogenesis (Lee and Cha, 2018). In addition to being intermediates of fructolysis and glycolysis, triose phosphates are also intermediates of glyceroneogenesis and gluconeogenesis (Masania et al., 2016). Moreover, TMP replacement inhibited the expression of the FBP1 gene relative to SP. FBP1 is a rate-limiting enzyme in hepatic gluconeogenesis that is increased by obesity and dietary fat intake (Visinoni et al., 2012). Thus, TMP can inhibit fructolysis/gluconeogenesis in obese rodents induced by a HFD. Gutierrez et al. (2021) have reported that KHK inhibition prevents fructose metabolism in the liver, resulting in suppressed ChREBP, insulin resistance, and de novo lipogenesis (DNL). ChREBP and SREBP-1c are important transcriptional regulators in liver X receptor-mediated hepatic lipogenesis through the upregulation of fatty acid synthase and acetyl-CoA carboxylase (Xu et al., 2013). ChREBP is a glucose-responsive factor that is essential for fructose-induced lipogenesis and gluconeogenesis in the liver (Iizuka et al., 2004; Ma et al., 2006; Shin et al., 2016; Lee and Cha, 2018). Hepatic deletion or suppression of ChREBP decreases the expression of enzymes involved in glycolysis, gluconeogenesis, lipogenesis, and very low-density lipoprotein packaging and secretion, which protects against obesity and insulin resistance (Katz et al., 2021). In this study, the dose-dependent replacement of TMP decreased ChREBP gene expression but not SREBP-1c gene expression relative to SP. In addition, the ChREBP-downstream genes FAS and DGAT2 were substantially lower in the TMP group (more than 40% for FAS and more than 20% for DGAT2) than in the SP group. Thus, TMP appears to inhibit ChREBP-mediated fatty acid and triglyceride synthesis to suppress fructose-induced lipogenesis and gluconeogenesis.

The present study also observed a significant decrease in PPARγ expression in the S2T3 group (60% TMP-replacement group) compared to the SP group. PPARγ plays a crucial role in regulating lipid metabolism, targeting genes involved in DNL and free fatty acid uptake (Skat-Rørdam et al., 2019). It also modulates adipogenic genes such as adipocyte fatty acid-binding protein and CD36, promoting free fatty acid uptake. Increased hepatic PPARγ expression has been observed in patients with NAFLD (Skat-Rørdam et al., 2019). Moreover, Matsusue et al. (2014) reported that liver-specific knockout of PPARγ in ob/ob mice significantly reduced hepatic triglyceride content compared to control mice. In addition, the expression of the SCD1 gene was down-regulated in the S2T3 group compared to the SP group. SCD1 is an enzyme involved in lipogenesis, converting saturated fatty acids to monounsaturated fatty acids, and is encoded by the SCD1 gene, downstream of the PPARγ and ChREBP signaling pathways (Tao et al., 2021). Furthermore, histological observations revealed an increase in hepatic lipid droplets and vacuolization in the SP group, while the TMP-replacement groups showed a reduction in lipid droplets in the liver. These findings indicate that the substitution of 60% TMP for SP suppresses hepatic fatty acid uptake and lipogenic genes in HFD-induced obese mice by down-regulating the ChREBP/PPARγ pathway.

In contrast, the present investigation demonstrated that TMP replacement decreased DLD and SOD1 expression relative to SP. During glucose metabolism and mitochondrial adenosine triphosphate production, the enzyme DLD participates in the decarboxylation of pyruvate to form acetyl-CoA. DLD can either promote or suppress reactive oxygen species (ROS) depending on pathophysiological conditions (Chen et al., 2002; Yan et al., 2008; Ambrus et al., 2011; Yan et al., 2013; Quinlan et al., 2014; Yang et al., 2019). Yang et al. (2019) reported that the inhibition of DLD resulted in an antioxidant response to oxidative stress in stroke injuries. Under aerobic conditions, SOD inhibits iron mobilization from ferritin by DLD (Bando and Aki, 1990). According to a previous study (Ashraf and Sheikh, 2015), ROS production is one of the main mechanisms for the progression of steatosis during ER stress. ER is predominantly involved in protein folding and post-translational modification. The PDI family of enzymes and other oxidoreductases, which contribute to the generation of ROS, mediate the formation of the disulfide bond in proteins (Zhang et al., 2019). Compared to SP, the TMP replacement inhibited the expression of the PDI gene in the current study. Although the exact mechanism by which TMP is involved in oxidative and ER stress is unknown, it has been demonstrated that partial replacement of SP with TMP reduces oxidative and ER stress markers. Through the regulation of ER stress, antioxidant defense, fructolysis/gluconeogenesis, lipogenesis, and their transcriptional factors, increasing the mix ratio of TMP could reduce HFD-induced lipid accumulation in mice compared to the SP group. SP and TMP were combined in a ratio of 2:3 to improve glucose and lipid metabolism in the liver tissues of HFD-induced obese mice. This mixture ratio can be used to produce functionally processed goods.

ACKNOWLEDGEMENTS

We sincerely appreciate Suncheon Research Center for Bio Health Care for providing TMP.

FUNDING

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. NRF-2020R1A2C1009008).

AUTHOR DISCLOSURE STATEMENT

The authors declare no conflict of interest.

AUTHOR CONTRIBUTIONS

Concept and design: all authors. Analysis and interpretation: all authors. Data collection: RYC. Writing the article: all authors. Critical revision of the article: MKL. Final approval of the article: all authors. Statistical analysis: RYC. Obtained funding: MKL. Overall responsibility: all authors.

Fig 1.

Figure 1.Histological appearance of epididymal white adipose tissue and liver in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Magnification: 200×. H&E, hematoxylin and eosin.
Preventive Nutrition and Food Science 2023; 28: 255-262https://doi.org/10.3746/pnf.2023.28.3.255

Fig 2.

Figure 2.Gene expression related to hepatic fructolysis/gluconeogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.
Preventive Nutrition and Food Science 2023; 28: 255-262https://doi.org/10.3746/pnf.2023.28.3.255

Fig 3.

Figure 3.Gene expression related to hepatic lipogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a,b) above the bars indicate significant differences among the groups.
Preventive Nutrition and Food Science 2023; 28: 255-262https://doi.org/10.3746/pnf.2023.28.3.255

Fig 4.

Figure 4.Gene expression of hepatic transcription factors in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups. 
Preventive Nutrition and Food Science 2023; 28: 255-262https://doi.org/10.3746/pnf.2023.28.3.255

Fig 5.

Figure 5.Gene expression of hepatic endoplasmic reticulum stress and antioxidant-related genes in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.
Preventive Nutrition and Food Science 2023; 28: 255-262https://doi.org/10.3746/pnf.2023.28.3.255

Table 1 . Dietary composition in experiments1)

Ingredients (%)SPS4T1S3T2S2T3
SP20.016.012.08.0
TMP4.08.012.0
DL-methionine0.30.30.30.3
Choline bitartrate0.20.20.20.2
Corn starch34.034.034.034.0
Sucrose15.015.015.015.0
Cellulose5.05.05.05.0
Corn oil3.03.03.03.0
Lard18.018.018.018.0
Mineral mixture2)3.53.53.53.5
Vitamin mixture3)1.01.01.01.0

1)Experimental diets were adjusted ratio for protein contents.

2)Mineral mixture according to AIN-76.

3)Vitamin mixture according to AIN-76.

SP, soy protein; TMP, mealworm fermentation extract.


Table 2 . Primer sequences for quantitative real-time polymerase chain reaction based on reverse transcription

GeneNameForward/reverse (5’-3’)
ALDOBFructose bisphosphate aldolase BGCTGTGTTGAGGATTGCTGA/TAGACAGCAGCCAGGACCTT
CD36Cluster of differentiation 36GCTGTCAGGCGTCAGGATAA/TGGCTTCAGGGAGACTGTTG
ChREBPCarbohydrate-response element-binding proteinCTGGGGACCTAAACAGGAGC/GAAGCCACCCTATAGCTCCC
DGAT2Diacylglycerol O-acyltransferase 2CTGGCTGATAGCTGCTCTCTACTTG/TGTGATCTCCTGCCACCTTTC
DLDDihydrolipoyl dehydrogenaseCCTTGTAGCTACGGGCTCAG/CCCACATGACCCAAAAATTC
FASFatty acid synthaseTTGGAGCTAAGGCATGGTGG/GCAGTTGTCCTCTGGATGCT
FBP1Fructose-1,6-bisphosphatase 1GTCTGTTTCGATCCCCTTGA/GTCCAGCATGAAGCAGTTGA
GAPDHGlyceraldehyde-3-phosphate dehydrogenaseAAGGTCATCCCAGAGCTGAA/CTGCTTCACCACCTTCTTGA
KHKKetohexokinaseTCGAGTGAAGAAAGGGGCTA/CCTTCGAGAGGCTGAAGATG
PAPPhosphatidate phosphatase 1GGGTTCTACTGTGGAGATGA/TGACAGTAGCTGTGATGATGA
PDIProtein disulfide isomeraseTATGATGGGCCTAGGACTGC/TGCTGGCTGCTTTTAGGAAT
PPARγPeroxisome proliferator-activated receptor gammaTCGCTGATGCACTGCCTATG/GAGAGGTCCACAGAGCTGAT
SCD1Stearoyl-CoA desaturaseTTCTTCATCGACTGCATGGC/ACTCAGAAGCCCAAAGCTCAG
SOD1Superoxide dismutase 1CCAGTGCAGGACCTCATTTT/TTGTTTCTCATGGACCACCA
SREBP-1cSterol regulatory element-binding protein 1cAACCTCATCCGCCACCTG/TGGTAGACAACAGCCGCATC

Table 3 . Obese mice given high-fat diets with a TMP/SP mix had different body weights, food intakes, serum glucose, insulin, and leptin levels, and HOMA-IR

SPS4T1S3T2S2T3
Body weights (g)
0 week19.20±0.3319.53±0.2419.53±0.2419.54±0.24
3 week26.07±0.2626.19±0.5725.85±0.2925.40±0.38
6 week31.79±0.5132.67±0.9832.16±0.5531.22±0.63
9 week37.81±0.7138.83±1.2237.32±0.7935.17±0.71
10 week39.49±0.76ab40.66±1.27b39.25±0.95ab36.65±0.78a
11 week40.65±0.82ab41.71±1.23b40.77±0.94ab37.67±0.80a
12 week41.23±0.82ab42.41±1.16b41.92±0.94ab38.41±0.82a
Body weight gain (g)22.02±0.59b22.87±1.04b22.39±0.77b18.93±0.77a
Food intakes (g/d)3.93±0.05b3.71±0.05ab3.70±0.08ab3.45±0.07a
Serum glucose (mmol/L)14.10±1.6314.96±1.1512.99±1.0310.52±0.69
Serum insulin (μIU/mL)100.53±26.93ab153.37±33.27b132.20±21.30ab51.27±8.70a
Serum leptin (ng/mL)7.23±1.23ab8.57±1.04b7.58±0.80ab4.46±0.78a
HOMA-IR68.18±21.59ab97.57±20.04b79.84±17.00ab25.49±5.45a

The data are shown as mean±SE. Means with distinct letters (a,b) in a row show statistically significant differences between groups.

TMP, mealworm fermentation extract; SP, soy protein; HOMA-IR, homeostasis model assessment of insulin resistance.


References

  1. Abboud KY, Reis SK, Martelli ME, Zordão OP, Tannihão F, de Souza AZZ, et al. Oral glutamine supplementation reduces obesity, pro-inflammatory markers, and improves insulin sensitivity in DIO Wistar rats and reduces waist circumference in overweight and obese humans. Nutrients. 2019. 11:536. https://doi.org/10.3390/nu11030536.
    Pubmed KoreaMed CrossRef
  2. Ambrus A, Torocsik B, Tretter L, Ozohanics O, Adam-Vizi V. Stimulation of reactive oxygen species generation by disease-causing mutations of lipoamide dehydrogenase. Hum Mol Genet. 2011. 20:2984-2995.
    Pubmed CrossRef
  3. Araujo TR, Freitas IN, Vettorazzi JF, Batista TM, Santos-Silva JC, Bonfleur ML, et al. Benefits of L-alanine or L-arginine supplementation against adiposity and glucose intolerance in monosodium glutamate-induced obesity. Eur J Nutr. 2017. 56:2069-2080.
    Pubmed CrossRef
  4. Ashraf NU, Sheikh TA. Endoplasmic reticulum stress and oxidative stress in the pathogenesis of non-alcoholic fatty liver disease. Free Radic Res. 2015. 49:1405-1418.
    Pubmed CrossRef
  5. Bando Y, Aki K. Superoxide-mediated release of iron from ferritin by some flavoenzymes. Biochem Biophys Res Commun. 1990. 168:389-395.
    Pubmed CrossRef
  6. Chen HJ, Chen YM, Chang CM. Lipoyl dehydrogenase catalyzes reduction of nitrated DNA and protein adducts using dihydrolipoic acid or ubiquinol as the cofactor. Chem Biol Interact. 2002. 140:199-213.
    Pubmed CrossRef
  7. Choi BS, Daniel N, Houde VP, Ouellette A, Marcotte B, Varin TV, et al. Feeding diversified protein sources exacerbates hepatic insulin resistance via increased gut microbial branched-chain fatty acids and mTORC1 signaling in obese mice. Nat Commun. 2021. 12:3377. https://doi.org/10.1038/s41467-021-23782-w.
    Pubmed KoreaMed CrossRef
  8. Choi RY, Ham JR, Ryu HS, Lee SS, Miguel MA, Paik MJ, et al. Defatted Tenebrio molitor larva fermentation extract modifies steatosis, inflammation and intestinal microflora in chronic alcohol-fed rats. Nutrients. 2020a. 12:1426. https://doi.org/10.3390/nu12051426.
    Pubmed KoreaMed CrossRef
  9. Choi RY, Ji M, Lee MK, Paik MJ. Metabolomics study of serum from a chronic alcohol-fed rat model following administration of defatted Tenebrio molitor larva fermentation extract. Metabolites. 2020b. 10:436. https://doi.org/10.3390/metabo10110436.
    Pubmed KoreaMed CrossRef
  10. Drummen M, Tischmann L, Gatta-Cherifi B, Adam T, Westerterp-Plantenga M. Dietary protein and energy balance in relation to obesity and co-morbidities. Front Endocrinol. 2018. 9:443. https://doi.org/10.3389/fendo.2018.00443.
    Pubmed KoreaMed CrossRef
  11. Feng S. Tenebrio molitor L., entomophagy and processing into ready to use therapeutic ingredients: a review. J Nutr Health Food Eng. 2018. 8:280-285.
    CrossRef
  12. Gessner DK, Schwarz A, Meyer S, Wen G, Most E, Zorn H, et al. Insect meal as alternative protein source exerts pronounced lipid-lowering effects in hyperlipidemic obese Zucker rats. J Nutr. 2019. 149:566-577.
    Pubmed CrossRef
  13. Gutierrez JA, Liu W, Perez S, Xing G, Sonnenberg G, Kou K, et al. Pharmacologic inhibition of ketohexokinase prevents fructose-induced metabolic dysfunction. Mol Metab. 2021. 48:101196. https://doi.org/10.1016/j.molmet.2021.101196.
    Pubmed KoreaMed CrossRef
  14. Ham JR, Choi RY, Lee Y, Lee MK. Effects of edible insect Tenebrio molitor larva fermentation extract as a substitute protein on hepatosteatogenesis and proteomic changes in obese mice induced by high-fat diet. Int J Mol Sci. 2021. 22:3615. https://doi.org/10.3390/ijms22073615.
    Pubmed KoreaMed CrossRef
  15. Iizuka K, Bruick RK, Liang G, Horton JD, Uyeda K. Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis. Proc Natl Acad Sci U S A. 2004. 101:7281-7286.
    Pubmed KoreaMed CrossRef
  16. Iizuka K. The transcription factor carbohydrate-response element-binding protein (ChREBP): A possible link between metabolic disease and cancer. Biochim Biophys Acta Mol Basis Dis. 2017. 1863:474-485.
    Pubmed CrossRef
  17. Ijaz MU, Ahmed MI, Zou X, Hussain M, Zhang M, Zhao F, et al. Beef, casein, and soy proteins differentially affect lipid metabolism, triglycerides accumulation and gut microbiota of high-fat diet-fed C57BL/6J mice. Front Microbiol. 2018. 9:2200. https://doi.org/10.3389/fmicb.2018.02200.
    Pubmed KoreaMed CrossRef
  18. Katz LS, Baumel-Alterzon S, Scott DK, Herman MA. Adaptive and maladaptive roles for ChREBP in the liver and pancreatic islets. J Biol Chem. 2021. 296:100623. https://doi.org/10.1016/j.jbc.2021.100623.
    Pubmed KoreaMed CrossRef
  19. Lee HJ, Cha JY. Recent insights into the role of ChREBP in intestinal fructose absorption and metabolism. BMB Rep. 2018. 51:429-436.
    Pubmed KoreaMed CrossRef
  20. Ma L, Robinson LN, Towle HC. ChREBP*Mlx is the principal mediator of glucose-induced gene expression in the liver. J Biol Chem. 2006. 281:28721-28730.
    Pubmed CrossRef
  21. Masania J, Malczewska-Malec M, Razny U, Goralska J, Zdzienicka A, Kiec-Wilk B, et al. Dicarbonyl stress in clinical obesity. Glycoconj J. 2016. 33:581-589. https://doi.org/10.1007/s10719-016-9692-0.
    Pubmed KoreaMed CrossRef
  22. Matsusue K, Aibara D, Hayafuchi R, Matsuo K, Takiguchi S, Gonzalez FJ, et al. Hepatic PPARγ and LXRα independently regulate lipid accumulation in the livers of genetically obese mice. FEBS Lett. 2014. 588:2277-2281.
    Pubmed KoreaMed CrossRef
  23. Quinlan CL, Goncalves RL, Hey-Mogensen M, Yadava N, Bunik VI, Brand MD. The 2-oxoacid dehydrogenase complexes in mitochondria can produce superoxide/hydrogen peroxide at much higher rates than complex I. J Biol Chem. 2014. 289:8312-8325.
    Pubmed KoreaMed CrossRef
  24. Shepherd EL, Saborano R, Northall E, Matsuda K, Ogino H, Yashiro H, et al. Ketohexokinase inhibition improves NASH by reducing fructose-induced steatosis and fibrogenesis. JHEP Rep. 2020. 3:100217. https://doi.org/10.1016/j.jhepr.2020.100217.
    Pubmed KoreaMed CrossRef
  25. Shin E, Bae JS, Han JY, Lee J, Jeong YS, Lee HJ, et al. Hepatic DGAT2 gene expression is regulated by the synergistic action of ChREBP and SP1 in HepG2 cells. Anim Cells Syst. 2016. 20:7-14.
    CrossRef
  26. Skat-Rørdam J, Højland Ipsen D, Lykkesfeldt J, Tveden-Nyborg P. A role of peroxisome proliferator-activated receptor g in non-alcoholic fatty liver disease. Basic Clin Pharmacol Toxicol. 2019. 124:528-537.
    Pubmed KoreaMed CrossRef
  27. Tao L, Guo X, Xu M, Wang Y, Xie W, Chen H, et al. Dexmedetomidine ameliorates high-fat diet-induced nonalcoholic fatty liver disease by targeting SCD1 in obesity mice. Pharmacol Res Perspect. 2021. 9:e00700. https://doi.org/10.1002/prp2.700.
    Pubmed KoreaMed CrossRef
  28. Torre-Villalvazo I, Tovar AR, Ramos-Barragán VE, Cerbón-Cervantes MA, Torres N. Soy protein ameliorates metabolic abnormalities in liver and adipose tissue of rats fed a high fat diet. J Nutr. 2008. 138:462-468.
    Pubmed CrossRef
  29. Velasquez MT, Bhathena SJ. Role of dietary soy protein in obesity. Int J Med Sci. 2007. 4:72-82.
    Pubmed KoreaMed CrossRef
  30. Visinoni S, Khalid NF, Joannides CN, Shulkes A, Yim M, Whitehead J, et al. The role of liver fructose-1,6-bisphosphatase in regulating appetite and adiposity. Diabetes. 2012. 61:1122-1132.
    Pubmed KoreaMed CrossRef
  31. Wycherley TP, Moran LJ, Clifton PM, Noakes M, Brinkworth GD. Effects of energy-restricted high-protein, low-fat compared with standard-protein, low-fat diets: a meta-analysis of randomized controlled trials. Am J Clin Nutr. 2012. 96:1281-1298.
    Pubmed CrossRef
  32. Xu X, So JS, Park JG, Lee AH. Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Semin Liver Dis. 2013. 33:301-311.
    Pubmed KoreaMed CrossRef
  33. Yan LJ, Sumien N, Thangthaeng N, Forster MJ. Reversible inactivation of dihydrolipoamide dehydrogenase by mitochondrial hydrogen peroxide. Free Radic Res. 2013. 47:123-133.
    Pubmed KoreaMed CrossRef
  34. Yan LJ, Thangthaeng N, Forster MJ. Changes in dihydrolipoamide dehydrogenase expression and activity during postnatal development and aging in the rat brain. Mech Ageing Dev. 2008. 129:282-290.
    Pubmed KoreaMed CrossRef
  35. Yang X, Song J, Yan LJ. Chronic inhibition of mitochondrial dihydrolipoamide dehydrogenase (DLDH) as an approach to managing diabetic oxidative stress. Antioxidants. 2019. 8:32. https://doi.org/10.3390/antiox8020032.
    Pubmed KoreaMed CrossRef
  36. Zhang Y, Guo K, LeBlanc RE, Loh D, Schwartz GJ, Yu YH. Increasing dietary leucine intake reduces diet-induced obesity and improves glucose and cholesterol metabolism in mice via multimechanisms. Diabetes. 2007. 56:1647-1654.
    Pubmed CrossRef
  37. Zhang Z, Zhang L, Zhou L, Lei Y, Zhang Y, Huang C. Redox signaling and unfolded protein response coordinate cell fate decisions under ER stress. Redox Biol. 2019. 25:101047. https://doi.org/10.1016/j.redox.2018.11.005.
    Pubmed KoreaMed CrossRef