Obesity and its associated comorbidities, such as type 2 diabetes, cardiovascular disease, hypertension, and cancer have increased worldwide (Drummen et al., 2018). Carbohydrate response element-binding protein (ChREBP) plays a crucial role in the development of non-alcoholic fatty liver disease (NAFLD), glucose intolerance, dyslipidemia and cancer, and controls the transcription of genes involved in glucose and lipid metabolism, impacting these clinical diseases (Iizuka, 2017). Controlling dietary protein consumption has recently been identified as a viable method for reducing obesity (Ijaz et al., 2018). A prior meta-analysis found that an isocaloric high-protein diet is superior to a conventional protein diet in terms of weight reduction, body composition, and management of resting energy expenditure (Wycherley et al., 2012). Indeed, casein has been employed as the only protein component in the majority of commercially purified diets for obesity (Choi et al., 2021). Soy protein (SP) is classified as a complete protein as it includes the majority of the necessary amino acids present in animal protein and is approximately similar to high-biological-value animal protein (Velasquez and Bhathena, 2007). Torre-Villalvazo et al. (2008) found that long-term (180-day) SP treatment had positive effects on the liver and adipose tissue in rats, even when given a high-fat diet (HFD).

Tenebrio molitor larva (mealworm) is a nutritious edible insect that provides essential amino acids, polyunsaturated fatty acids, trace elements, and vitamins (Feng, 2018). Gessner et al. (2019) reported that isonitrogenous substitution of 50% and 100% of casein with mealworm meal had lipid-lowering benefits in a hyperlipidemic rat model. The purpose of this study was to see how different ratios of mealworm fermentation extract (TMP) and SP mix (20, 40, or 60% TMP) affected hepatic glucose and lipid metabolism-related gene expression in HFD-induced obese mice.

Animals and diets

Male C57BL/6N mice aged 4 weeks (n=40) were bought from Orient Bio Inc., and kept under normal circumstances (22±2°C, 50±5% humidity, and a 12-h light/dark cycle). The Sunchon National University’s Institutional Animal Care and Use Committee (SCNU_IACUC_2020-08) gave its approval to the protocol. The mice were divided into 4 groups of 10 mice each after a week of acclimatization. The mice were given HFD supplemented with SP (Shandong Yuxin Bio-Tech Co., Ltd.) as the control or three concentrations of TMP (20, 40, and 60%) and SP mix (S4T1, S3T2, and S2T3), each of which included 20% protein sources, in three different ratios. Table 1 contains a list of the experimental diets and their ingredients. The mice have limitless access to food and water at all times. Three times a week, the diet was modified, and once a week, the body weight was recorded. The overnight-starved mice were put to death with inhalation after the 12-week trial, and blood was taken from the inferior vena cava as described in our prior work (Ham et al., 2021). In preparation for further examination, the liver and white adipose tissues (WAT) were extracted and kept at −80°C. For histological investigation, certain tissue samples were fixed in 10% neutral buffered formalin. According to the preceding instructions, the TMP was extracted (Choi et al., 2020a). In the yeast extract–peptone–dextrose medium, defatted and freeze-dried mealworm powder was used to replace peptone. After being infused into the broth, the Saccharomyces cerevisiae strain (KCTC 17299) from the Korean Cell Line Bank was incubated for 72 h at 32±3°C. The yeast/mealworm fermentation broth (1 L) was then extracted with 1 L of fermented alcohol at a 70% concentration. The sample extractions underwent filtering, evaporation, and freeze-drying.

Table 1 . Dietary composition in experiments¹⁾.

Ingredients (%)	SP	S4T1	S3T2	S2T3
SP	20.0	16.0	12.0	8.0
TMP	−	4.0	8.0	12.0
DL-methionine	0.3	0.3	0.3	0.3
Choline bitartrate	0.2	0.2	0.2	0.2
Corn starch	34.0	34.0	34.0	34.0
Sucrose	15.0	15.0	15.0	15.0
Cellulose	5.0	5.0	5.0	5.0
Corn oil	3.0	3.0	3.0	3.0
Lard	18.0	18.0	18.0	18.0
Mineral mixture2)	3.5	3.5	3.5	3.5
Vitamin mixture3)	1.0	1.0	1.0	1.0

¹⁾Experimental diets were adjusted ratio for protein contents..

²⁾Mineral mixture according to AIN-76..

³⁾Vitamin mixture according to AIN-76..

SP, soy protein; TMP, mealworm fermentation extract..

Serum biochemical assays

Using an assay kit, the glucose level was determined (Asan Pharmaceutical Co., Ltd.). Enzyme-linked immunosorbent assay kits from R&D Systems, Inc. and Morinaga Institute of Biological Science, Inc. were used to measure the levels of leptin and insulin, respectively. The equation fasting insulin (μIU/mL)×fasting glucose (mmol/L)/22.5 was used to calculate the homeostasis model assessment of insulin resistance (HOMA-IR).

Histological analysis

Hematoxylin and eosin (H&E) staining was performed on the paraffin-embedded fixed liver and epididymal WAT. Oil Red O was used to stain the liver slices. A 200× optical microscope was used to magnify the tiny pictures for observation.

RNA isolation and reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis

The total RNA was isolated using the TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc.). RNA content was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Complementary DNA synthesis was performed using a ReverTra Ace qPCR RT master mix (Toyobo). The RT-qPCR analysis was conducted using the CFX96 Touch™ real-time PCR detection system (Bio-Rad Laboratories, Inc.) with an SYBR green PCR kit (Qiagen). The primer details can be found in Table 2.

Table 2 . Primer sequences for quantitative real-time polymerase chain reaction based on reverse transcription.

Gene	Name	Forward/reverse (5’-3’)
ALDOB	Fructose bisphosphate aldolase B	GCTGTGTTGAGGATTGCTGA/TAGACAGCAGCCAGGACCTT
CD36	Cluster of differentiation 36	GCTGTCAGGCGTCAGGATAA/TGGCTTCAGGGAGACTGTTG
ChREBP	Carbohydrate-response element-binding protein	CTGGGGACCTAAACAGGAGC/GAAGCCACCCTATAGCTCCC
DGAT2	Diacylglycerol O-acyltransferase 2	CTGGCTGATAGCTGCTCTCTACTTG/TGTGATCTCCTGCCACCTTTC
DLD	Dihydrolipoyl dehydrogenase	CCTTGTAGCTACGGGCTCAG/CCCACATGACCCAAAAATTC
FAS	Fatty acid synthase	TTGGAGCTAAGGCATGGTGG/GCAGTTGTCCTCTGGATGCT
FBP1	Fructose-1,6-bisphosphatase 1	GTCTGTTTCGATCCCCTTGA/GTCCAGCATGAAGCAGTTGA
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	AAGGTCATCCCAGAGCTGAA/CTGCTTCACCACCTTCTTGA
KHK	Ketohexokinase	TCGAGTGAAGAAAGGGGCTA/CCTTCGAGAGGCTGAAGATG
PAP	Phosphatidate phosphatase 1	GGGTTCTACTGTGGAGATGA/TGACAGTAGCTGTGATGATGA
PDI	Protein disulfide isomerase	TATGATGGGCCTAGGACTGC/TGCTGGCTGCTTTTAGGAAT
PPARγ	Peroxisome proliferator-activated receptor gamma	TCGCTGATGCACTGCCTATG/GAGAGGTCCACAGAGCTGAT
SCD1	Stearoyl-CoA desaturase	TTCTTCATCGACTGCATGGC/ACTCAGAAGCCCAAAGCTCAG
SOD1	Superoxide dismutase 1	CCAGTGCAGGACCTCATTTT/TTGTTTCTCATGGACCACCA
SREBP-1c	Sterol regulatory element-binding protein 1c	AACCTCATCCGCCACCTG/TGGTAGACAACAGCCGCATC

Statistical analysis

Statistical analysis was performed using IBM SPSS software (version 20, IBM Corp.). The data are presented as mean±standard error. One-way ANOVA was utilized to determine significant differences among the groups, followed by Tukey’s test. Statistical significance was considered at a threshold of P<0.05.

Body weight, food intake, and insulin resistance index

There were no significant changes in weekly body weights for the first 9 weeks. However, after 10 weeks on the experimental diet, the body weights in the S2T3 group showed a trend toward being lower compared to the SP, S4T1, and S3T2 groups (Table 3). By the 12th week, the S2T3 group exhibited a significantly reduced body weight gain compared to the other groups (Table 3). Furthermore, the S2T3 group demonstrated a significant decrease in food intake compared to the SP group (Table 3). Serum glucose levels did not show significant statistical changes among the four groups (Table 3). Nevertheless, the serum insulin and leptin levels, as well as the HOMA-IR index, tended to be reduced in the S2T3 group compared to the SP group (Table 3).

Table 3 . Obese mice given high-fat diets with a TMP/SP mix had different body weights, food intakes, serum glucose, insulin, and leptin levels, and HOMA-IR.

	SP	S4T1	S3T2	S2T3
Body weights (g)
0 week	19.20±0.33	19.53±0.24	19.53±0.24	19.54±0.24
3 week	26.07±0.26	26.19±0.57	25.85±0.29	25.40±0.38
6 week	31.79±0.51	32.67±0.98	32.16±0.55	31.22±0.63
9 week	37.81±0.71	38.83±1.22	37.32±0.79	35.17±0.71
10 week	39.49±0.76ab	40.66±1.27b	39.25±0.95ab	36.65±0.78a
11 week	40.65±0.82ab	41.71±1.23b	40.77±0.94ab	37.67±0.80a
12 week	41.23±0.82ab	42.41±1.16b	41.92±0.94ab	38.41±0.82a
Body weight gain (g)	22.02±0.59b	22.87±1.04b	22.39±0.77b	18.93±0.77a
Food intakes (g/d)	3.93±0.05b	3.71±0.05ab	3.70±0.08ab	3.45±0.07a
Serum glucose (mmol/L)	14.10±1.63	14.96±1.15	12.99±1.03	10.52±0.69
Serum insulin (μIU/mL)	100.53±26.93ab	153.37±33.27b	132.20±21.30ab	51.27±8.70a
Serum leptin (ng/mL)	7.23±1.23ab	8.57±1.04b	7.58±0.80ab	4.46±0.78a
HOMA-IR	68.18±21.59ab	97.57±20.04b	79.84±17.00ab	25.49±5.45a

The data are shown as mean±SE. Means with distinct letters (a,b) in a row show statistically significant differences between groups..

TMP, mealworm fermentation extract; SP, soy protein; HOMA-IR, homeostasis model assessment of insulin resistance..

Morphological changes in the adipose tissue and liver

The histological examination of epididymal WAT stained with H&E revealed that the adipocyte size was smaller in proportion to the substitution ratio of TMP replacing SP (Fig. 1). In the histological analysis of hepatic tissues using H&E staining, the SP group exhibited a noticeable increase in fat vacuoles, while the TMP-replacement groups (S4T1, S3T2, and S2T3) showed fewer lipid droplets (Fig. 1). The presence of Oil Red O-positive lipid droplets in the SP group was observed throughout the liver, whereas increasing the TMP-replacement ratio resulted in reduced lipid accumulation compared to the SP group (Fig. 1).

Figure 1. Histological appearance of epididymal white adipose tissue and liver in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Magnification: 200×. H&E, hematoxylin and eosin.

Changes in expression of gene controlling hepatic fructolysis/gluconeogenesis

Fig. 2 demonstrates that the gene expression of KHK and ALDOB was significantly suppressed when TMP substitution levels exceeded 60%. Similarly, the gene expression of DLD and FBP1 was down-regulated with increasing substitution of SP by TMP (Fig. 2). Notably, these four genes exhibited a pronounced down-regulation in the S2T3 group compared to the SP group.

Figure 2. Gene expression related to hepatic fructolysis/gluconeogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.

Changes in expression of gene controlling hepatic lipogenesis

In relation to fatty acid synthesis, the gene expression of FAS and SCD1 was significantly down-regulated at TMP-replacement levels exceeding 40% and 60%, respectively, compared to the SP group (Fig. 3). In addition, the mRNA expression of the fatty acid uptake-related gene CD36 was significantly decreased in the S3T2 and S2T3 groups compared to the SP group (Fig. 3). While the expression of PAP was lower in the TMP-replacement groups, no significant differences were observed (Fig. 3). Furthermore, the mRNA levels of the triglyceride synthesis gene DGAT2 were significantly down-regulated in the S4T1, S3T2, and S2T3 groups compared to the SP group (Fig. 3).

Figure 3. Gene expression related to hepatic lipogenesis in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a,b) above the bars indicate significant differences among the groups.

Changes in expression of hepatic transcription factor genes

The mRNA levels of glucose and lipid metabolism-related transcription factors were measured (Fig. 4). The PPARγ gene expression in the S2T3 group was significantly lower than in the SP group. As the addition ratio of TMP increased, the ChREBP gene expression in the TMP-replacement groups was down-regulated compared with the SP group. The TMP replacement did not affect the SREBP-1c gene expression.

Figure 4. Gene expression of hepatic transcription factors in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups. 

Changes in expression of hepatic endoplasmic reticulum (ER) stress and antioxidant gene expression

Major indicators of ER-related stress and antioxidants, respectively, are PDI and SOD1. In a dose-dependent manner, the expression levels of the PDI and SOD1 genes were reduced in the TMP-replacement groups in comparison to the SP group (Fig. 5).

Figure 5. Gene expression of hepatic endoplasmic reticulum stress and antioxidant-related genes in obese mice fed high-fat diets with varying ratios of mealworm fermentation extract and soy protein (SP) mix. Data are presented as mean±SE. Different letters (a-c) above the bars indicate significant differences among the groups.

We previously reported that glutamic acid, leucine, and alanine were the most prevalent amino acids in TMP (Choi et al., 2020b). Zhang et al. (2007) discovered that dietary leucine supplementation decreases HFD-induced hypercholesterolemia, hyperglycemia, and adiposity in rodents. L-alanine or L-arginine administration has been found to reduce obesity and glucose intolerance in mice induced to be obese by monosodium glutamate (Araujo et al., 2017). Glutamine supplementation decreases adipose mass and enhances insulin sensitivity in HFD-fed Wistar rodents, according to Abboud et al. (2019). The present study demonstrated that as the ratio of TMP to SP in the mixture increased, the expression of genes implicated in ChREBP-mediated glucose and lipid metabolism improved in NAFLD. Specifically, the 60% ratio by TMP (S2T3 group) substantially decreased the KHK and ALDOB genes relative to the SP group. Shepherd et al. (2020) reported that KHK catalyzes fructose into fructose-1-phosphate, which is then cleaved by ALDOB into glyceraldehyde and dihydroxyacetone-phosphate. Triokinase converts glyceraldehyde to glyceraldehyde 3-phosphate, which is then converted to glucose by gluconeogenesis or further metabolized into acetyl-CoA, resulting in lipogenesis (Lee and Cha, 2018). In addition to being intermediates of fructolysis and glycolysis, triose phosphates are also intermediates of glyceroneogenesis and gluconeogenesis (Masania et al., 2016). Moreover, TMP replacement inhibited the expression of the FBP1 gene relative to SP. FBP1 is a rate-limiting enzyme in hepatic gluconeogenesis that is increased by obesity and dietary fat intake (Visinoni et al., 2012). Thus, TMP can inhibit fructolysis/gluconeogenesis in obese rodents induced by a HFD. Gutierrez et al. (2021) have reported that KHK inhibition prevents fructose metabolism in the liver, resulting in suppressed ChREBP, insulin resistance, and de novo lipogenesis (DNL). ChREBP and SREBP-1c are important transcriptional regulators in liver X receptor-mediated hepatic lipogenesis through the upregulation of fatty acid synthase and acetyl-CoA carboxylase (Xu et al., 2013). ChREBP is a glucose-responsive factor that is essential for fructose-induced lipogenesis and gluconeogenesis in the liver (Iizuka et al., 2004; Ma et al., 2006; Shin et al., 2016; Lee and Cha, 2018). Hepatic deletion or suppression of ChREBP decreases the expression of enzymes involved in glycolysis, gluconeogenesis, lipogenesis, and very low-density lipoprotein packaging and secretion, which protects against obesity and insulin resistance (Katz et al., 2021). In this study, the dose-dependent replacement of TMP decreased ChREBP gene expression but not SREBP-1c gene expression relative to SP. In addition, the ChREBP-downstream genes FAS and DGAT2 were substantially lower in the TMP group (more than 40% for FAS and more than 20% for DGAT2) than in the SP group. Thus, TMP appears to inhibit ChREBP-mediated fatty acid and triglyceride synthesis to suppress fructose-induced lipogenesis and gluconeogenesis.

The present study also observed a significant decrease in PPARγ expression in the S2T3 group (60% TMP-replacement group) compared to the SP group. PPARγ plays a crucial role in regulating lipid metabolism, targeting genes involved in DNL and free fatty acid uptake (Skat-Rørdam et al., 2019). It also modulates adipogenic genes such as adipocyte fatty acid-binding protein and CD36, promoting free fatty acid uptake. Increased hepatic PPARγ expression has been observed in patients with NAFLD (Skat-Rørdam et al., 2019). Moreover, Matsusue et al. (2014) reported that liver-specific knockout of PPARγ in ob/ob mice significantly reduced hepatic triglyceride content compared to control mice. In addition, the expression of the SCD1 gene was down-regulated in the S2T3 group compared to the SP group. SCD1 is an enzyme involved in lipogenesis, converting saturated fatty acids to monounsaturated fatty acids, and is encoded by the SCD1 gene, downstream of the PPARγ and ChREBP signaling pathways (Tao et al., 2021). Furthermore, histological observations revealed an increase in hepatic lipid droplets and vacuolization in the SP group, while the TMP-replacement groups showed a reduction in lipid droplets in the liver. These findings indicate that the substitution of 60% TMP for SP suppresses hepatic fatty acid uptake and lipogenic genes in HFD-induced obese mice by down-regulating the ChREBP/PPARγ pathway.

In contrast, the present investigation demonstrated that TMP replacement decreased DLD and SOD1 expression relative to SP. During glucose metabolism and mitochondrial adenosine triphosphate production, the enzyme DLD participates in the decarboxylation of pyruvate to form acetyl-CoA. DLD can either promote or suppress reactive oxygen species (ROS) depending on pathophysiological conditions (Chen et al., 2002; Yan et al., 2008; Ambrus et al., 2011; Yan et al., 2013; Quinlan et al., 2014; Yang et al., 2019). Yang et al. (2019) reported that the inhibition of DLD resulted in an antioxidant response to oxidative stress in stroke injuries. Under aerobic conditions, SOD inhibits iron mobilization from ferritin by DLD (Bando and Aki, 1990). According to a previous study (Ashraf and Sheikh, 2015), ROS production is one of the main mechanisms for the progression of steatosis during ER stress. ER is predominantly involved in protein folding and post-translational modification. The PDI family of enzymes and other oxidoreductases, which contribute to the generation of ROS, mediate the formation of the disulfide bond in proteins (Zhang et al., 2019). Compared to SP, the TMP replacement inhibited the expression of the PDI gene in the current study. Although the exact mechanism by which TMP is involved in oxidative and ER stress is unknown, it has been demonstrated that partial replacement of SP with TMP reduces oxidative and ER stress markers. Through the regulation of ER stress, antioxidant defense, fructolysis/gluconeogenesis, lipogenesis, and their transcriptional factors, increasing the mix ratio of TMP could reduce HFD-induced lipid accumulation in mice compared to the SP group. SP and TMP were combined in a ratio of 2:3 to improve glucose and lipid metabolism in the liver tissues of HFD-induced obese mice. This mixture ratio can be used to produce functionally processed goods.

We sincerely appreciate Suncheon Research Center for Bio Health Care for providing TMP.

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. NRF-2020R1A2C1009008).

The authors declare no conflict of interest.

Concept and design: all authors. Analysis and interpretation: all authors. Data collection: RYC. Writing the article: all authors. Critical revision of the article: MKL. Final approval of the article: all authors. Statistical analysis: RYC. Obtained funding: MKL. Overall responsibility: all authors.